si:ch211-147a11.5

Ensembl ID:
ENSDARG00000060361
ZFIN ID:
ZDB-GENE-060503-195
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L9D2]
Human Orthologue:
KIAA0562
Human Description:
KIAA0562 [Source:HGNC Symbol;Acc:24866]
Mouse Orthologue:
BC046331
Mouse Description:
cDNA sequence BC046331 Gene [Source:MGI Symbol;Acc:MGI:2687282]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38687 Nonsense Mutation detected in F1 DNA During 2017
sa11679 Nonsense Available for shipment Available now
sa5770 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa38687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 294 972 8 22
ENSDART00000135949   None 144 None 4
ENSDART00000137645 Nonsense 270 712 8 15
Genomic Location (Zv9):
Chromosome 8 (position 22928405)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22299581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGCCGGTATGATGTGGAGAAACTCAGTGCAATAGAACGAGAGGACTA[T/G]GACACAGCCAAGCAGAAAAAGGAACAAATGGATGCTTACAGACTCGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 473 972 11 22
ENSDART00000135949   None 144 None 4
ENSDART00000137645 Nonsense 449 712 11 15
Genomic Location (Zv9):
Chromosome 8 (position 22922982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22294158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCTTTCTCTTGTGTCTGTTAGGTGGCAGGAGCCTATTCCAAGACATG[G/A]TCCYACAGAGAGGATGCTTTGCTGGCAGTCCGCAAGAAACTGATGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5770
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 622 972 13 22
ENSDART00000135949   None 144 None 4
ENSDART00000137645 Nonsense 598 712 13 15
ENSDART00000084965 Nonsense 622 972 13 22
ENSDART00000135949   None 144 None 4
ENSDART00000137645 Nonsense 598 712 13 15
Genomic Location (Zv9):
Chromosome 8 (position 22914482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22285658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCTAGACWGGCACTGAGCAGACTGGAACTGATTGAGAAGCTTCTAGAA[C/T]AGCTGGGCACCAAGGACTCTGGCTTCACCCTTGACAGCATCATGCGGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link