map3k3

Ensembl ID:
ENSDARG00000060348
ZFIN ID:
ZDB-GENE-070910-1
Human Orthologue:
MAP3K3
Human Description:
mitogen-activated protein kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6855]
Mouse Orthologue:
Map3k3
Mouse Description:
mitogen-activated protein kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1346874]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1697 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa1697
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084932 Essential Splice Site 263 620 9 16
Genomic Location:
Chromosome 3 (position 31963547)
KASP Assay ID:
554-1643.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAACACACAGGATTAAGAGTTATCCTGACAACCGACAAGACTGCTCAGG[T/C]GCATYTCATATCAGTTGCTTTCCCGCTTAAGTTTTACAAATGAGCTGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association study of body height in African Americans: the Women's Health Initiative SNP Health Association Resource (SHARe). (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/te60yh8y