si:dkey-157l19.2

Ensembl ID:
ENSDARG00000060340
ZFIN ID:
ZDB-GENE-090313-190
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A570]
Human Orthologue:
KIAA1522
Human Description:
KIAA1522 [Source:HGNC Symbol;Acc:29301]
Mouse Orthologue:
C77080
Mouse Description:
expressed sequence C77080 Gene [Source:MGI Symbol;Acc:MGI:2140651]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5864 Nonsense Mutation detected in F1 DNA During 2017
sa11087 Nonsense Available for shipment Available now
sa42253 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14517 Nonsense Available for shipment Available now
sa38961 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084929   None 1390 None 7
ENSDART00000133565 Nonsense 14 221 1 5
Genomic Location (Zv9):
Chromosome 13 (position 36436143)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35908712
KASP Assay ID:
554-3664.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCACTATTCCAGACTCACTGCTCTCTGAGGGACGACTTTGTCCGAAAA[C/T]AGTTTTGTGGAAATGCCTCACCTGAACTTTCCAGACCAGACTCACATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084929 Nonsense 123 1390 2 7
ENSDART00000133565 Nonsense 177 221 3 5
Genomic Location (Zv9):
Chromosome 13 (position 36397229)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35869798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAATATGTGTTGGACCTCCACACAGAAGCCCAGCAGGGCCTGAAACTG[C/T]AACAGCAAGAGGGTAGGAAGACTTYAAAATCAGTCTGCTTTTGTAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084929 Essential Splice Site 189 1390 5 7
ENSDART00000133565   None 221 None 5
Genomic Location (Zv9):
Chromosome 13 (position 36396658)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35869227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTTCAAATATACAATGCCAAAGAAAAAATTCTCATTTCCTTTCTCC[A/T]GCCTCAACATTCAGGCCTCTGAAACCAGATAAGTCTGCAGAGAAGCCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084929 Nonsense 276 1390 6 7
ENSDART00000133565   None 221 None 5
Genomic Location (Zv9):
Chromosome 13 (position 36396304)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35868873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTAGCAGCTCTGAAMAAGAAAGCTTACAAGACTATCCACAGAGAGGA[C/T]AGAACCTGCACATACTTTTGGAAAACAACACAGAGGTCCCCATGCTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084929 Nonsense 1123 1390 7 7
ENSDART00000133565   None 221 None 5
Genomic Location (Zv9):
Chromosome 13 (position 36393667)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35866236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTAACTGAATCAGAGCCTCAATCAAACCACATTGACCAAACAAGAGTA[G/T]AGCCAACATGCTCATCACCTACTGAACCAAGTACCGCTTCAGCTCCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link