si:ch211-284e13.4

Ensembl ID:
ENSDARG00000060330
ZFIN ID:
ZDB-GENE-060526-161
Description:
Novel protein similar to vertebrate insulin receptor substrate 1 (IRS1) [Source:UniProtKB/TrEMBL;Acc
Mouse Orthologue:
Irs3
Mouse Description:
insulin receptor substrate 3 Gene [Source:MGI Symbol;Acc:MGI:1194882]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18812 Nonsense Mutation detected in F1 DNA During 2017
sa33659 Nonsense Mutation detected in F1 DNA During 2017
sa26532 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa2220 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa18812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890 Nonsense 112 513 2 7
ENSDART00000131831 Nonsense 123 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39692222)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37491612
KASP Assay ID:
2259-6232.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATAATCTTACTGTCTTTTATTTTATATCTGTAGGTAAGACTCCTGAT[G/T]AGTGCGGCAGTGGAGGAGACTGTGGACTACCTTCCCCGGGCCCTGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890   None 513 None 7
ENSDART00000131831 Nonsense 465 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39691196)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37490586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGTTACATCCTAATGGGTCACAGAGAAGGCTCTCACAAACGTGTTCAT[G/T]GACGCAGAGTCCTTCGCCGTTCATCTAGCCGCGAGTGTGAAGTTGAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890 Splice Site None 513 None 7
ENSDART00000131831 Nonsense 556 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39690923)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37490313
KASP Assay ID:
2259-6231.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGCAGGAAAACTCTGCAGATAAAGGTGTGAGTACAAAAGGGGGTCCT[G/T]AAGACTCCTCAATTGACAGTGGTTACATGTCCATGTTACCAGGCGTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2220
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890 Nonsense 498 513 7 7
ENSDART00000131831 Nonsense 678 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39690557)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37489947
KASP Assay ID:
554-2778.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGTCAGCTTGCAGTACTCCTCCATCACACCCAGAGCAACAGCCACTG[C/T]AGCCAAAGATGGTCTATTCATATTTTTCAYTACCACGTTCCTACAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link