si:dkey-193b15.3

Ensembl ID:
ENSDARG00000060326
ZFIN ID:
ZDB-GENE-070912-412
Description:
Novel protein similar to human and mouse microtubule-associated protein 1A (MAP1A) [Source:UniProtKB
Human Orthologue:
MAP1S
Human Description:
microtubule-associated protein 1S [Source:HGNC Symbol;Acc:15715]
Mouse Orthologue:
Mtap1s
Mouse Description:
microtubule-associated protein 1S Gene [Source:MGI Symbol;Acc:MGI:2443304]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39884 Nonsense Mutation detected in F1 DNA During 2017
sa10222 Nonsense Available for shipment Available now
sa10988 Nonsense Available for shipment Available now
sa17782 Splice Site, Nonsense Available for shipment Available now
sa32965 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 147 1294 4 9
ENSDART00000124217 Nonsense 144 1318 4 7
ENSDART00000124563 Nonsense 144 560 4 6
Genomic Location (Zv9):
Chromosome 2 (position 36646794)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36943504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGGACAGTCTCTTGAAGACTCTGGAGATCTGGTCTTGCACACGGGG[C/T]AATTCACGCCAAATGATTTCACCCAGATCTTTTCAGATGAAGAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
Genomic Location (Zv9):
Chromosome 2 (position 36645886)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36942596
KASP Assay ID:
2259-2332.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTAATGTACTACGAAGCAGTGATTTAGCAGGATTYATATTACAGCATT[T/A]GGAGAAACTGAAGATCTCACYAGAGCCCCTTTTTCGCAATTCAACTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
Genomic Location (Zv9):
Chromosome 2 (position 36645886)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36942596
KASP Assay ID:
2259-2332.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTAATGTACTACGAAGCAGTGATTTAGCAGGATTYATATTACAGCATT[T/A]GGAGAAACTGAAGATCTCACYAGAGCCCCTTTTTCGCAATTCAACTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 585 1294 5 9
ENSDART00000124217 Nonsense 582 1318 5 7
ENSDART00000124563 Splice Site None 560 None 6
Genomic Location (Zv9):
Chromosome 2 (position 36645265)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36941975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AARCAWTGCAAAACAAAACCCCTCCAGACTTGTTACAAGAAAGGAGTCTT[T/A]GAAGGACAAAAGCAGTGAAAAAACAAACAAATCAGACTCAAAGAAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 711 1294 5 9
ENSDART00000124217 Nonsense 708 1318 5 7
ENSDART00000124563   None 560 None 6
Genomic Location (Zv9):
Chromosome 2 (position 36644888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36941598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCTCACCTGAAGATATGACAGCAGAATTTCTGCAAATGGATCGAGAA[C/T]AACACGAATTACTTGCGAAGAGTCAAGCTGTTGACTCTGGAAACCTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link