exoc5

Ensembl ID:
ENSDARG00000060323
ZFIN ID:
ZDB-GENE-080204-126
Description:
exocyst complex component 5 [Source:RefSeq peptide;Acc:NP_001107268]
Human Orthologue:
EXOC5
Human Description:
exocyst complex component 5 [Source:HGNC Symbol;Acc:10696]
Mouse Orthologue:
Exoc5
Mouse Description:
exocyst complex component 5 Gene [Source:MGI Symbol;Acc:MGI:2145645]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42993 Nonsense Mutation detected in F1 DNA During 2016
sa23168 Nonsense Available for shipment Available now
sa42992 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130198 Nonsense 90 708 3 19
Genomic Location (Zv9):
Chromosome 17 (position 44479551)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44319229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGCCAAGGAGTTTGCTCACAAGGTTCAAGACCTTCAAAGGAGCAAC[C/T]AAGTCAGTCGTCTTTACATTTGTTTGCATTTGTTTATTTTTTAACCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130198 Nonsense 377 708 11 19
Genomic Location (Zv9):
Chromosome 17 (position 44469427)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44309105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCGGCATGATTCTTCAGCGCTATTATGATTCCAAGAACCACCAAAAA[C/T]GACCTGTAGGCACTGGAAGGTGAGGAATTGTTGGTTTCTTTGGTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130198 Nonsense 633 708 17 19
Genomic Location (Zv9):
Chromosome 17 (position 44464638)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44304316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGCAGCAGTTCAGCTACAGCTCCATGGGTGGCATGCTGGCCATCTG[T/A]GATGTGGCAGAATACCGCCGCTCTGCCAAAGATTTCCGGGTAAGGACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link