dcaf5

Ensembl ID:
ENSDARG00000060320
ZFIN ID:
ZDB-GENE-060929-808
Description:
DDB1- and CUL4-associated factor 5 [Source:RefSeq peptide;Acc:NP_001071020]
Human Orthologue:
DCAF5
Human Description:
DDB1 and CUL4 associated factor 5 [Source:HGNC Symbol;Acc:20224]
Mouse Orthologue:
Dcaf5
Mouse Description:
DDB1 and CUL4 associated factor 5 Gene [Source:MGI Symbol;Acc:MGI:2444785]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30670 Nonsense Mutation detected in F1 DNA During 2017
sa31947 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084867 Nonsense 223 789 5 8
ENSDART00000135804   None 499 None 3
Genomic Location (Zv9):
Chromosome 13 (position 36826550)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36298709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGCTTTGTGCTCATGTGTATCTGTGTGTCTGTGCTGCAGTTCTCTGT[T/A]GCGGTACGGAGGCAGTTTGTCTCTTCAGAGTGCCATGAGTGTTCGCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084867 Essential Splice Site 356 789 7 8
ENSDART00000135804 Essential Splice Site 66 499 2 3
Genomic Location (Zv9):
Chromosome 13 (position 36820216)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36292785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTCACACGTACATGATCTGCTCCTCCGGGGTGGAGAAGGTCATCAAG[G/T]TCAGCTAATTCTTTCATTTAAGCATAACAGAAACAAACATAGTCTTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link