NP_001071041.1

Ensembl ID:
ENSDARG00000060319
Description:
sodium channel, voltage-gated, type IV, beta b [Source:RefSeq peptide;Acc:NP_001071041]
Human Orthologue:
SCN4B
Human Description:
sodium channel, voltage-gated, type IV, beta [Source:HGNC Symbol;Acc:10592]
Mouse Orthologue:
Scn4b
Mouse Description:
sodium channel, type IV, beta Gene [Source:MGI Symbol;Acc:MGI:2687406]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14304 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084868 Essential Splice Site 205 232 5 6
Genomic Location (Zv9):
Chromosome 5 (position 39522353)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37321743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTAAAGAACTTAACCCTGTTCATTCTCGCAAAGATGGAGGAAAAAAA[G/A]TGAGTTTATTTATAACACCTTACTATAACTCTTACTCTAAGTTACTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link