si:dkey-193b15.6

Ensembl ID:
ENSDARG00000060315
ZFIN ID:
ZDB-GENE-070912-414
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S6B7]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16529 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084859 Nonsense 113 320 4 8
Genomic Location (Zv9):
Chromosome 2 (position 36621863)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36918573
KASP Assay ID:
2259-2327.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGACCGAGGACCAAGTGGWTGAATTGRCCAAGGAGCTTTCAAAAGTC[A/T]AACAGCTTCTTGTGGTAACAGAGGAGGAGAAGCGAGRAAAAGAGGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link