si:ch211-152c12.2

Ensembl ID:
ENSDARG00000060312
ZFIN ID:
ZDB-GENE-060503-291
Description:
Novel protein similar to vertebrate mouse mitogen-activated protein kinase binding protein 1-like (M
Human Orthologue:
WDR62
Human Description:
WD repeat domain 62 [Source:HGNC Symbol;Acc:24502]
Mouse Orthologue:
Wdr62
Mouse Description:
WD repeat domain 62 Gene [Source:MGI Symbol;Acc:MGI:1923696]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11070 Nonsense Available for shipment Available now
sa28400 Nonsense Mutation detected in F1 DNA During 2017
sa16137 Nonsense Available for shipment Available now
sa22583 Essential Splice Site Available for shipment Available now
sa8577 Nonsense Mutation detected in F1 DNA During 2017
sa5875 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084850 Nonsense 164 1478 5 31
ENSDART00000099509 Nonsense 175 1519 5 32
ENSDART00000114410 Nonsense 125 1439 4 30
ENSDART00000143726   None 252 None 6
Genomic Location (Zv9):
Chromosome 15 (position 5483202)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5626929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTATATAGTGTCTGTGGGATACCAACACGACAGGACTGTCAGCGTCT[G/A]GGAGTGGAAGGTGGGTTTTATCTGCCCRACTRCTATGAAGAGCTGYGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084850 Nonsense 275 1478 8 31
ENSDART00000099509 Nonsense 290 1519 8 32
ENSDART00000114410 Nonsense 236 1439 7 30
ENSDART00000143726   None 252 None 6
Genomic Location (Zv9):
Chromosome 15 (position 5491304)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5618827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCTAACTCAGTGTGTCTTTGTTTTGCTGTTGTAGACTACATCAGCA[C/T]AGTGTTTATCAGTGAGCGGGACGTTTGTTTTTTGCGGTTGTGCCGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084850 Nonsense 335 1478 9 31
ENSDART00000099509 Nonsense 350 1519 9 32
ENSDART00000114410 Nonsense 296 1439 8 30
ENSDART00000143726   None 252 None 6
Genomic Location (Zv9):
Chromosome 15 (position 5494605)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5615526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAMKTCTACTTTTCTAGGCATTTGTTCAGTGCAAATCCAGAAGCACARTA[T/A]CCAGATACCTTGGCTTTAACYTTTGACCCCGTGACCAAGCACTTGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084850 Essential Splice Site 1360 1478 29 31
ENSDART00000099509 Essential Splice Site 1401 1519 30 32
ENSDART00000114410 Essential Splice Site 1321 1439 28 30
ENSDART00000143726   None 252 None 6
Genomic Location (Zv9):
Chromosome 15 (position 5527717)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5582414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGACAATCAAGATTCTGCAGATAACAACAGCATTCCAGAGGAAACGG[G/A]TAGGTTAAATACACACAAATGCCTCACTTTGTTTGAAACAGAGTTTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084850 Nonsense 1421 1478 31 31
ENSDART00000099509 Nonsense 1462 1519 32 32
ENSDART00000114410 Nonsense 1382 1439 30 30
ENSDART00000143726   None 252 None 6
Genomic Location (Zv9):
Chromosome 15 (position 5530994)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5579137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATGAAGGGCGTTTTGCAGGAGGTGTTTGTGGGGGTACAGAGCGAGT[T/A]AAATTCAATCTGCCCACAAAAGACAYAACCATCGACTAAGAGCACCCRTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084850 Nonsense 1430 1478 31 31
ENSDART00000099509 Nonsense 1471 1519 32 32
ENSDART00000114410 Nonsense 1391 1439 30 30
ENSDART00000143726   None 252 None 6
Genomic Location (Zv9):
Chromosome 15 (position 5531020)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5579111
KASP Assay ID:
554-3773.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTGGGGGTACAGAGCGAGTTAAATTCAATCTGCCCACAAAAGACA[C/T]AACCATCGACTAAGAGCACCCRTCCCATATCAGAGGACTCTCCAGGTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link