LOC100333650

Ensembl ID:
ENSDARG00000060308
Human Orthologue:
URB1
Human Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Mouse Orthologue:
Urb1
Mouse Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146468]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35802 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42480 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22582 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109599 Essential Splice Site 119 1558 3 26
Genomic Location (Zv9):
Chromosome 15 (position 5406537)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5703594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCTGGAGGCTCGAAACAAGCTGCCGGACAGTTTTAAAGACGCGAAAG[G/T]TAAATCACATATTTTTTAAAATGTAGTTAAGAGATTTGGCTTAAAGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109599 Essential Splice Site 866 1558 15 26
Genomic Location (Zv9):
Chromosome 15 (position 5429884)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5680247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCCTCCAGGAATATGAGAAGAACAACATTAGTCTTGCAGAATTTCAG[T/A]ACGTTTCAGATCAAGCATGATTCCCACAGACAGAGAGAGGCTGTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109599 Essential Splice Site 1133 1558 21 26
Genomic Location (Zv9):
Chromosome 15 (position 5443638)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5666493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCTGCTGGCTTTTGCAAGCACATCACTCTGTGACCAGGCCACTCAGG[T/C]GGGAAAAATGTTATTAAAATGTGGTGCTATTGAGCAAAAAAACTCAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link