LOC100333650

Ensembl ID:
ENSDARG00000060308
Human Orthologue:
URB1
Human Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Mouse Orthologue:
Urb1
Mouse Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146468]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22582 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109599 Essential Splice Site 1133 1558 21 26
Genomic Location:
Chromosome 15 (position 5443638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCTGCTGGCTTTTGCAAGCACATCACTCTGTGACCAGGCCACTCAGG[T/C]GGGAAAAATGTTATTAAAATGTGGTGCTATTGAGCAAAAAAACTCAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ea4wnk8k