si:ch211-210c8.8

Ensembl ID:
ENSDARG00000060306
ZFIN ID:
ZDB-GENE-030131-2523
Human Orthologue:
TFCP2
Human Description:
transcription factor CP2 [Source:HGNC Symbol;Acc:11748]
Mouse Orthologue:
Tcfcp2
Mouse Description:
transcription factor CP2 Gene [Source:MGI Symbol;Acc:MGI:98509]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18190 Nonsense Available for shipment Available now
sa17044 Essential Splice Site Available for shipment Available now
sa29979 Nonsense Mutation detected in F1 DNA During 2017
sa9853 Nonsense Available for shipment Available now
sa19332 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084848 Nonsense 31 512 1 16
ENSDART00000138416 Nonsense 31 512 2 17

The following transcripts of ENSDARG00000060306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33893067)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33752865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGTCTGGWCTGGTCCARGACTTTGATGCCAGTCTGTCAGGGATCGGG[C/T]AAGAGCTTGGAGCTGGTGCTTACAGCATGAGGTGAGATTCATCACTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084848 Essential Splice Site 324 512 9 16
ENSDART00000138416 Essential Splice Site 324 512 10 17

The following transcripts of ENSDARG00000060306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33883780)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33743578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCCAGTCACCAGCCAGAGCCTGTCGCACAGTTAGCGGATGTGAGTG[T/A]ATGTGTATTTTTTTTCTTCCTCTCTCATATCYGATATCCACTGCTCWCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084848 Nonsense 420 512 13 16
ENSDART00000138416 Nonsense 420 512 14 17

The following transcripts of ENSDARG00000060306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33878219)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33738017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAAGGCTCACAATCTATGTTTGCCAGGAATCCCAACAGGCTCGTGAA[C/T]AGCACCAGAAACATGAGAACGGAGACGGGACTAACAACACTTTTTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084848 Nonsense 437 512 14 16
ENSDART00000138416 Nonsense 437 512 15 17
ENSDART00000084848 Nonsense 437 512 14 16
ENSDART00000138416 Nonsense 437 512 15 17

The following transcripts of ENSDARG00000060306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33876971)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33736769
KASP Assay ID:
554-6199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTTGTTTTCATGTGGAATMTCATGTTTCTTTACCCAATGTTAGTGTA[T/G]CACGCCATCTATCTGGAGGATTTAACCGCWGTGGAACTGACGGAAAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084848 Nonsense 437 512 14 16
ENSDART00000138416 Nonsense 437 512 15 17
ENSDART00000084848 Nonsense 437 512 14 16
ENSDART00000138416 Nonsense 437 512 15 17

The following transcripts of ENSDARG00000060306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33876971)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33736769
KASP Assay ID:
554-6199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTGTTTTCATGTGGAATCTCATGTTTCTTTACCCAATGTTAGTGTA[T/G]CACGCCATCTATCTGGAGGATTTAACCGCTGTGGAACTGACGGAAAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link