si:ch211-207m11.1

Ensembl ID:
ENSDARG00000060304
ZFIN ID:
ZDB-GENE-060503-22
Description:
Novel protein similar to vertebrate microtubule associated protein (MAP) family [Source:UniProtKB/Tr
Human Orthologue:
MAP7D1
Human Description:
MAP7 domain containing 1 [Source:HGNC Symbol;Acc:25514]
Mouse Orthologue:
Mtap7d1
Mouse Description:
microtubule-associated protein 7 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28706 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084827   None 236 None 8
ENSDART00000142002 Nonsense 497 754 11 18
Genomic Location (Zv9):
Chromosome 16 (position 40075511)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35799892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCCAGCGCCCTCTCCTGGCAAACCCATGGCTGGCACAAACAACCCA[G/T]AGGAGGCCACCCGCATCTTGGCTGAGAAGAGACGACAGGCTCGCGAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link