si:ch73-255e3.1

Ensembl ID:
ENSDARG00000060303
ZFIN ID:
ZDB-GENE-081105-62
Description:
Novel protein similar to vertebrate solute carrier family 4, sodium bicarbonate cotransporter protei
Human Orthologue:
SLC4A10
Human Description:
solute carrier family 4, sodium bicarbonate transporter, member 10 [Source:HGNC Symbol;Acc:13811]
Mouse Orthologue:
Slc4a10
Mouse Description:
solute carrier family 4, sodium bicarbonate cotransporter-like, member 10 Gene [Source:MGI Symbol;Ac

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6119 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15332 Nonsense Available for shipment Available now
sa13363 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084806 Essential Splice Site 76 900 2 21
ENSDART00000139316   None 573 None 11
Genomic Location (Zv9):
Chromosome 9 (position 52701570)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51823792
KASP Assay ID:
554-3707.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGACATCGGCAAGAAGCAGTCAGAGTCCAACTGCTTGGACAAAAACG[G/A]TACTCGATTACCATCATTCAGAATTCACAGAAGGTATTSGTGTTATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084806 Nonsense 174 900 5 21
ENSDART00000139316   None 573 None 11
Genomic Location (Zv9):
Chromosome 9 (position 52687019)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51809241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGTTTCTGTTCATCCTTCTCGGACCTCTGGGAAAAGGAGCTCAGTA[T/A]CACGAGATYGGCAGATCCATCGCAACCTTGATGACAGATGAGGTATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084806 Nonsense 747 900 17 21
ENSDART00000139316 Nonsense 479 573 10 11
Genomic Location (Zv9):
Chromosome 9 (position 52648829)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51771141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACATGTTTRCTTCTGCTTTTTCTYGTGATCTTAGTTTTTCGAYCGTT[T/A]GAGATTGTTCGGGATGCCGGCTAAACAYCAGCCAGACTTCATTTACCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link