si:ch211-282c13.6

Ensembl ID:
ENSDARG00000060298
ZFIN IDs:
ZDB-GENE-070725-1, ZDB-GENE-070725-1, ZDB-GENE-090312-130
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A6H4]
Human Orthologue:
NIN
Human Description:
ninein (GSK3B interacting protein) [Source:HGNC Symbol;Acc:14906]
Mouse Orthologue:
Nin
Mouse Description:
ninein Gene [Source:MGI Symbol;Acc:MGI:105108]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11160 Essential Splice Site Available for shipment Available now
sa11058 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084815 Essential Splice Site 323 741 9 16
ENSDART00000112007 Essential Splice Site 323 1272 8 24
ENSDART00000129562   None 340 None 8
Genomic Location (Zv9):
Chromosome 13 (position 37231553)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36703855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATTACAGGAWGTTTTTAATKAGCTTTTATGCATGCTTTTTATTTTGT[A/G]GGCTCTGGATTTTAATCTGGAAGGTAAAGTGAATCTGTCGGAGCTCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084815 Nonsense 465 741 11 16
ENSDART00000112007 Nonsense 465 1272 10 24
ENSDART00000129562   None 340 None 8
Genomic Location (Zv9):
Chromosome 13 (position 37228133)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36700435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCTTGAACAAGAAATTAGCAAGATGAGAGATGATGAAACCTTCCTA[C/T]GAGAACACCTAACGCTTACCATTAAAGTAATCATCACTGATTTCATGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link