si:ch211-139a5.8

Ensembl ID:
ENSDARG00000060297
ZFIN ID:
ZDB-GENE-060526-44
Description:
Novel protein similar to vertebrate glucocorticoid receptor DNA binding factor 1 (GRLF1) [Source:Uni
Human Orthologue:
GRLF1
Human Description:
glucocorticoid receptor DNA binding factor 1 [Source:HGNC Symbol;Acc:4591]
Mouse Orthologue:
Grlf1
Mouse Description:
glucocorticoid receptor DNA binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:1929494]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8435 Nonsense Mutation detected in F1 DNA During 2017
sa26529 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084819 Nonsense 490 1530 1 8
ENSDART00000138162 Nonsense 490 1517 1 6

The following transcripts of ENSDARG00000060297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 39474126)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37273775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGGACATTTATAACCGTCACCAGAAAGCAATCATTGACAGGGCAAAA[G/T]AGGATTTTCAGGAGCTTCTGCTGGAGTACTCTGAACTCTTCTACGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084819 Nonsense 1100 1530 1 8
ENSDART00000138162 Nonsense 1100 1517 1 6

The following transcripts of ENSDARG00000060297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 39472294)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37271943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGCCGTTCCCTCACATCCAATGTGACGTGGCCTCTAGGAGGAGATTA[T/A]GATCCTTCAGACTATGCTGAGCCAATGGATGCTGTCTCTAAGCCACGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link