cnga5

Ensembl ID:
ENSDARG00000060287
ZFIN ID:
ZDB-GENE-061005-1
Description:
cyclic nucleotide gated channel alpha 5 [Source:RefSeq peptide;Acc:NP_001038211]
Human Orthologue:
CNGA2
Human Description:
cyclic nucleotide gated channel alpha 2 [Source:HGNC Symbol;Acc:2149]
Mouse Orthologue:
Cnga2
Mouse Description:
cyclic nucleotide gated channel alpha 2 Gene [Source:MGI Symbol;Acc:MGI:108040]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22447 Nonsense Mutation detected in F1 DNA During 2014
sa22446 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084766 Nonsense 477 673 6 6
Genomic Location:
Chromosome 14 (position 17386305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACTGTGAGGCGGGGCTTTTGGTGGAACTTGTTCTTAAGCTGCGGCCA[C/T]AGGTCTTTAGTCCAGGAGACTACATCTGCAGAAAGGGAGACATAGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084766 Nonsense 604 673 6 6
Genomic Location:
Chromosome 14 (position 17385924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCGAGGAGGTGGAGGCAGACGGAATAGGGGTGGAAGATATTGAGAAA[A/T]GAGTAGAGAGGATGGAAGATACTATTGAAATATTACAAACTCGATTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mbjjmuv5