cnga5

Ensembl ID:
ENSDARG00000060287
ZFIN ID:
ZDB-GENE-061005-1
Description:
cyclic nucleotide gated channel alpha 5 [Source:RefSeq peptide;Acc:NP_001038211]
Human Orthologue:
CNGA2
Human Description:
cyclic nucleotide gated channel alpha 2 [Source:HGNC Symbol;Acc:2149]
Mouse Orthologue:
Cnga2
Mouse Description:
cyclic nucleotide gated channel alpha 2 Gene [Source:MGI Symbol;Acc:MGI:108040]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35663 Nonsense Mutation detected in F1 DNA During 2016
sa22447 Nonsense Mutation detected in F1 DNA During 2016
sa22446 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084766 Nonsense 239 673 6 6
Genomic Location:
Chromosome 14 (position 17387017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGTTCAAGCTTGACTTGCTATCAATAATACCCACAGATTTAGGTTA[C/A]ATCGTCATTGGCATTCATGTACCAGAGCTTCGTTTGAATAGACTTATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084766 Nonsense 477 673 6 6
Genomic Location:
Chromosome 14 (position 17386305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACTGTGAGGCGGGGCTTTTGGTGGAACTTGTTCTTAAGCTGCGGCCA[C/T]AGGTCTTTAGTCCAGGAGACTACATCTGCAGAAAGGGAGACATAGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084766 Nonsense 604 673 6 6
Genomic Location:
Chromosome 14 (position 17385924)
KASP Assay ID:
2260-7391.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCGAGGAGGTGGAGGCAGACGGAATAGGGGTGGAAGATATTGAGAAA[A/T]GAGTAGAGAGGATGGAAGATACTATTGAAATATTACAAACTCGATTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link