im:6907121

Ensembl ID:
ENSDARG00000060282
ZFIN ID:
ZDB-GENE-050809-3
Human Orthologue:
RNF121
Human Description:
ring finger protein 121 [Source:HGNC Symbol;Acc:21070]
Mouse Orthologue:
Rnf121
Mouse Description:
ring finger protein 121 Gene [Source:MGI Symbol;Acc:MGI:1922462]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14158 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084780 Essential Splice Site 173 331 6 9
Genomic Location:
Chromosome 21 (position 43316716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTTTACACGTACAARCTCMCGTCACCTCTGTTTCTGYTTKTA[G/T]GATAAAGSCAGACGATTGCATGGACCTTGGCGTTTCACTTCTCTTCTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r6fmoeyp