im:6907121

Ensembl ID:
ENSDARG00000060282
ZFIN ID:
ZDB-GENE-050809-3
Human Orthologue:
RNF121
Human Description:
ring finger protein 121 [Source:HGNC Symbol;Acc:21070]
Mouse Orthologue:
Rnf121
Mouse Description:
ring finger protein 121 Gene [Source:MGI Symbol;Acc:MGI:1922462]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14158 Essential Splice Site Available for shipment Available now
sa37383 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084780 Essential Splice Site 173 331 6 9
Genomic Location (Zv9):
Chromosome 21 (position 43316716)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44756374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTTTACACGTACAARCTCMCGTCACCTCTGTTTCTGYTTKTA[G/T]GATAAAGSCAGACGATTGCATGGACCTTGGCGTTTCACTTCTCTTCTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084780 Nonsense 309 331 9 9
Genomic Location (Zv9):
Chromosome 21 (position 43320181)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44759839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAGCGTCCGCATATGATGTACGGGCAGCTGCTGGACTGGCTGCGGTA[T/A]CTGGTGGCCTGGCAGCCCATTATCATTGGACTGGTACAACTCATCAATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link