A0JMH1_DANRE

Ensembl ID:
ENSDARG00000060263
Description:
LOC569386 protein [Source:UniProtKB/TrEMBL;Acc:A0JMH1]
Mouse Orthologue:
Pecam1
Mouse Description:
platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:97537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12952 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084729 Nonsense 352 747 6 15
Genomic Location:
Chromosome 3 (position 60205376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTCAGTGATCTCAAACAAGATCAGYAAAGAAGACATCAAGTATGTTT[T/A]GCTTAAAGATGGKCAACGCATTTCTACAAATCCCATCTTTCGCAAATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sd89b3c5