A0JMH1_DANRE

Ensembl ID:
ENSDARG00000060263
Description:
LOC569386 protein [Source:UniProtKB/TrEMBL;Acc:A0JMH1]
Mouse Orthologue:
Pecam1
Mouse Description:
platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:97537]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33336 Nonsense Mutation detected in F1 DNA During 2016
sa33337 Nonsense Mutation detected in F1 DNA During 2016
sa40187 Nonsense Mutation detected in F1 DNA During 2016
sa12952 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084729 Nonsense 222 747 4 15
Genomic Location (Zv9):
Chromosome 3 (position 60198960)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59501169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCACTGCAGGCTTCTCCAACAACAGCAACACCGTCAAAGTCTTTGTA[C/T]GAGGTAACGTAATACTGCTTGCCTAAAGACAATTGTTAATGGCATTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084729 Nonsense 322 747 6 15
Genomic Location (Zv9):
Chromosome 3 (position 60205287)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59507496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTCTTCAGCACTGTTTACAAGGCCAATCTTGACAATGAGCCCATA[T/A]GAGGTTTTTGAAGGGGAATTCTTCAAGCTGAACTGCAGCAGTTCAGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084729 Nonsense 331 747 6 15
Genomic Location (Zv9):
Chromosome 3 (position 60205312)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59507521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAATCTTGACAATGAGCCCATATGAGGTTTTTGAAGGGGAATTCTTC[A/T]AGCTGAACTGCAGCAGTTCAGTGATCTCAAACAAGATCAGCAAAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084729 Nonsense 352 747 6 15
Genomic Location (Zv9):
Chromosome 3 (position 60205376)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59507585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTCAGTGATCTCAAACAAGATCAGYAAAGAAGACATCAAGTATGTTT[T/A]GCTTAAAGATGGKCAACGCATTTCTACAAATCCCATCTTTCGCAAATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link