si:ch73-107c13.2

Ensembl ID:
ENSDARG00000060260
ZFIN ID:
ZDB-GENE-081104-242
Description:
Novel protein similar to vertebrate farnesyl-diphosphate farnesyltransferase 1 (FDFT1) [Source:UniPr
Human Orthologue:
FDFT1
Human Description:
farnesyl-diphosphate farnesyltransferase 1 [Source:HGNC Symbol;Acc:3629]
Mouse Orthologue:
Fdft1
Mouse Description:
farnesyl diphosphate farnesyl transferase 1 Gene [Source:MGI Symbol;Acc:MGI:102706]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6657 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37183 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084724 Essential Splice Site 127 418 3 8
ENSDART00000133280 Essential Splice Site 156 179 2 3
Genomic Location (Zv9):
Chromosome 20 (position 53557855)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53118247
KASP Assay ID:
554-5382.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCAGAGCAGAGAGAAGGACCGGCGCGTGCTGGAGGATTTCCCCACMG[T/A]CAGTACAACATCAACAACACACTCGAAACACTGCAGAACTTTTATTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084724 Nonsense 191 418 5 8
ENSDART00000133280   None 179 None 3
Genomic Location (Zv9):
Chromosome 20 (position 53551633)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53112025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGCGGGGCTGGTGGGCATCGGGCTCTCCCGGCTGTTCTCCGCATCC[C/T]AGCTGGAGGAGCCGGAGGTGGGCCGGGACACAGAGCTGGCCAACTCTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link