mogs

Ensembl ID:
ENSDARG00000060252
ZFIN ID:
ZDB-GENE-070112-412
Description:
mannosyl-oligosaccharide glucosidase [Source:RefSeq peptide;Acc:NP_001073659]
Human Orthologue:
MOGS
Human Description:
mannosyl-oligosaccharide glucosidase [Source:HGNC Symbol;Acc:24862]
Mouse Orthologue:
Mogs
Mouse Description:
mannosyl-oligosaccharide glucosidase Gene [Source:MGI Symbol;Acc:MGI:1929872]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7390 Missense Mutation detected in F1 DNA During 2016
sa39661 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084708 Missense 124 841 2 4
ENSDART00000132189 Missense 124 841 3 5
Genomic Location (Zv9):
Chromosome 1 (position 41992715)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40909031
KASP Assay ID:
554-4053.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTGTTACAARCATACCTTTTCTTTAGGTTTAATGTGGATGCACCAGT[T/G]TGCWGAAATGGATGGAAATCTCAGGCACACATGYGAGCAAGGGGACCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084708 Nonsense 759 841 4 4
ENSDART00000132189 Nonsense 759 841 5 5
Genomic Location (Zv9):
Chromosome 1 (position 41999053)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40915369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAGAGGAACACAGAACATGACGCCCCCTACTGGCGTGGACCCATCT[G/A]GATCAACATCAACTACCTGGCTGTTAGAGCACTGCATCACTATGGCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link