LOC793364

Ensembl ID:
ENSDARG00000060248
Human Orthologue:
FGD4
Human Description:
FYVE, RhoGEF and PH domain containing 4 [Source:HGNC Symbol;Acc:19125]
Mouse Orthologue:
Fgd4
Mouse Description:
FYVE, RhoGEF and PH domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2183747]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20183 Nonsense Mutation detected in F1 DNA During 2014
sa9921 Nonsense Available for shipment Available now
sa20184 Nonsense Available for shipment Available now
sa11713 Nonsense Available for shipment Available now
sa18772 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084691 Nonsense 25 653 1 14
Genomic Location:
Chromosome 4 (position 3193497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGTGCGCAGCGTCGTCATTTTCGGCTTCGGATCAGAGCTCCGGTT[G/A]GGACGTGTGGTCCGGCTGGTGGTCAGAAGAGGTCAGAGGTCAACAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084691 Nonsense 28 653 1 14
Genomic Location:
Chromosome 4 (position 3193506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGCGTCGTCATTTTCGGCTTCGGATCAGAGCTCMGRTTGGGACGTRT[G/A]GTCCGGCTGGTGGTCAGAAGAGGTCAGAGGTCAACAGGAGGAGTCCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084691 Nonsense 32 653 1 14
Genomic Location:
Chromosome 4 (position 3193519)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCGGCTTCGGATCAGAGCTCCGGTTGGGACGTGTGGTCCGGCTGGTG[G/A]TCAGAAGAGGTCAGAGGTCAACAGGAGGAGTCCGGCAGGGGAAACGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084691 Nonsense 435 653 11 14
Genomic Location:
Chromosome 4 (position 3205212)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTCACTGCTGTGCTTTTCTGCKTTACAGAAAGAAGARTTGGGCAAA[C/T]GAGCCCCGCGCTGGATTCGAGACAATGAAGTGACCATGTGYATGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084691 Essential Splice Site 567 653 13 14
Genomic Location:
Chromosome 4 (position 3207269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATACCGCAGCATGATGCACTGGTGCTGTACCTGTATGGTGCACCGCAG[G/T]TGAGAAACGCAGTCTATAGTGTTCATGGAAAACCTGGAAAAGTCGTGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fl7o6y63