enox1

Ensembl ID:
ENSDARG00000060243
ZFIN ID:
ZDB-GENE-081104-328
Description:
Novel protein similar to H.sapiens ENOX2, ecto-NOX disulfide-thiol exchanger 2 (ENOX2) [Source:UniPr
Human Orthologue:
ENOX1
Human Description:
ecto-NOX disulfide-thiol exchanger 1 [Source:HGNC Symbol;Acc:25474]
Mouse Orthologue:
Enox1
Mouse Description:
ecto-NOX disulfide-thiol exchanger 1 Gene [Source:MGI Symbol;Acc:MGI:2444896]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12978 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084668 Nonsense 616 626 15 15
ENSDART00000135277 None None 46 None 2
ENSDART00000146501 None None 460 None 9

The following transcripts of ENSDARG00000060243 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 18927882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTYAAGCAGGAGTTCAGCGGCGTAGGAGCGACACTGGAGAAACGCTGG[A/T]AGTTCTGCGGGTTCGAGGCTCTCAAGTCAGCGTGACTCTCAAAGCCACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bx198wuj