sb:cb472

Ensembl ID:
ENSDARG00000060238
ZFIN ID:
ZDB-GENE-030521-32
Human Orthologue:
UACA
Human Description:
uveal autoantigen with coiled-coil domains and ankyrin repeats [Source:HGNC Symbol;Acc:15947]
Mouse Orthologue:
Uaca
Mouse Description:
uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:19198

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31580 Nonsense Available for shipment Available now
sa40941 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40940 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10010 Nonsense Available for shipment Available now
sa9033 Nonsense Mutation detected in F1 DNA During 2017
sa11696 Nonsense Available for shipment Available now
sa7073 Nonsense Mutation detected in F1 DNA During 2017
sa10140 Nonsense Available for shipment Available now
sa15099 Nonsense Available for shipment Available now
sa20990 Nonsense Available for shipment Available now
sa7072 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 43 1385 2 21
Genomic Location (Zv9):
Chromosome 7 (position 35163066)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33557406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAAGGCAGTGGAGAGGAGGGAGGTGGACAAAGTCGCAGCAGTACTT[G/T]GAAAGAAGGGCATCATCCCCACTAAACTTGATGTTGAGGGCCGATCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Essential Splice Site 130 1385 6 21
Genomic Location (Zv9):
Chromosome 7 (position 35151011)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33545351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGCCTGGGGGAATGTTTAGGAATATTATTATTGTTTGTCTTTTCA[G/A]TCATGGCCGGCTGCTCCTCCAGCGTGAAGCTGCTCTGTGACAGTGGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Essential Splice Site 288 1385 12 21
Genomic Location (Zv9):
Chromosome 7 (position 35143928)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33538268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTTTTATTATTAGAGCTGACCATAGACATTTTCTGTATTAATAGAA[G/A]TTAGTGGACATTTAATGACTTTGTCTGCAATTGGCTGTGTGTTTTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 439 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141666)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33536006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTCTTCGCCAAGAGCTTGAATGTGCCCGCAGGCAGCAAGACGCTGCA[C/T]AAGAGGAAGTGGTCCACCTCCAAAAGGCTCTCGCAAGCAAGTCTCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 472 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141567)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTGAGGAGTTGACCAGGAAGTGTGAGACCATCAAGCGTGAGTCGGAT[C/T]AGCAGATACAGGAATTGGAAGAAGCCATGGGAGATGTGCAGAAGCGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 472 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141567)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTGAGGAGTTGACCAGGAAGTGTGAGACCATCAAGCGTGAGTCGGAT[C/T]AGCAGATACAGGAATTGGAAGAAGCCAYGGGAGATGTGCAGAAGCGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 546 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141345)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535685
KASP Assay ID:
554-4522.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGCTTCTGCTGAGGTTGGACGGGTCAGGAACCATTTAAAGCAGAGT[G/T]AGAAAGCGTTGGAGGAGTATAAGAAAAGTGAAGGGCTTCTGGCTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 751 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35140730)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGGYTCGATTAACAGAGGAGACCGAGAAGAACAAACAGGCTGAGGAG[C/T]ARATACGGAAGCTRCAGGAGGAGAAAACCTCTCTTTGTGAGAACATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 814 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35140540)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33534880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATAGCCTACAAGATCAAYACCAGRAGAAAGTCAGTGAACTTGAGGGTT[T/A]GGCAKCTGAAAAGGCAACACTGAAGCAGAGCTTTGACACAAAGTTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 1071 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35139770)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33534110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGGGCTGAACTGGAGGAGCAAAATGCATTGTGCAATTCTGAGATA[C/T]AGAGTCTTCAGCAGAAACTCAATAGTGAGTTCATCCACCTTGAGCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 1353 1385 20 21
Genomic Location (Zv9):
Chromosome 7 (position 35137095)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33531435
KASP Assay ID:
554-4353.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCTAAACAGGACGCTGAGAGGCAAYATAGAGAAGTGGTTTCAATTTA[T/A]CGAACTCATCTTCTCAGTGCAGCACAGGTAATTGTGTTTGAGTGTGCGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link