LOC100002448

Ensembl ID:
ENSDARG00000060235
Human Orthologue:
MST1R
Human Description:
macrophage stimulating 1 receptor (c-met-related tyrosine kinase) [Source:HGNC Symbol;Acc:7381]
Mouse Orthologue:
Mst1r
Mouse Description:
macrophage stimulating 1 receptor (c-met-related tyrosine kinase) Gene [Source:MGI Symbol;Acc:MGI:99

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20791 Nonsense Mutation detected in F1 DNA During 2014
sa20792 Nonsense Mutation detected in F1 DNA During 2014
sa18851 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8795 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20793 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084667 Nonsense 266 1350 1 20
Genomic Location:
Chromosome 6 (position 42411140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTCTTATCTGTGCAATGGGAGAGTCTAATGAAACCAAATGCGAAGT[T/A]GCAGACTCATCTTGGGCGTCTGCCGATTAAGGACAGCGAGCTTTGGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084667 Nonsense 411 1350 2 20
Genomic Location:
Chromosome 6 (position 42418002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTAGAATTCAGACAGTTTGACTTGCAAAACTACTCCCACCATGGTAT[C/G]AAAGCCTTACTACAGAGTGGACTTCTTCAATGGGCAGATGAGCAATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084667 Essential Splice Site 787 1350 9 20
ENSDART00000084667 Essential Splice Site 787 1350 9 20
Genomic Location:
Chromosome 6 (position 42424942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAGCCGTCATTAAATACAAAGGCGGCTACAAAGACCCTGTGGAAACC[G/T]TAAGACACATTTGTATTTTGATGGGGCATTTTAAAGGGATGGTTTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084667 Essential Splice Site 787 1350 9 20
ENSDART00000084667 Essential Splice Site 787 1350 9 20
Genomic Location:
Chromosome 6 (position 42424942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAGCCGTCATTAAATACAAAGGYGGCTACAAAGACCCTGTGSAAACC[G/T]TAAGACACATTTGTWTTTTGAYGGGGCATTTTAAAGGRATGGTTTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084667 Essential Splice Site 1082 1350 15 20
Genomic Location:
Chromosome 6 (position 42428883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGATAGTGATAACAAAGAGACCCACTGTGCAGTCAAATCACTGAATA[G/A]TAAGTAATTTAGCACTTGTTTTAATAATTGTTGTTTTTACATTACGTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2mc87hoj