si:ch211-11i5.2

Ensembl ID:
ENSDARG00000060215
ZFIN ID:
ZDB-GENE-030131-1998
Human Orthologue:
CCDC21
Human Description:
coiled-coil domain containing 21 [Source:HGNC Symbol;Acc:25309]
Mouse Orthologue:
Ccdc21
Mouse Description:
coiled-coil domain containing 21 Gene [Source:MGI Symbol;Acc:MGI:1917262]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16783 Nonsense Available for shipment Available now
sa12327 Nonsense Available for shipment Available now
sa36226 Essential Splice Site Available for shipment Available now
sa32107 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084610 Nonsense 361 746 5 12
ENSDART00000138798 Nonsense 378 763 7 14

The following transcripts of ENSDARG00000060215 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 44470268)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41750776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNNNNNTAATCTGTTTCTTTTCATYACTCTGTTTGTGACAGGAAGCACAR[C/T]GAGARAACGCATTCTTGCGAGCCCAGTTTGCCGAGCGCAACAACTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084610 Nonsense 443 746 6 12
ENSDART00000138798 Nonsense 460 763 8 14

The following transcripts of ENSDARG00000060215 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 44468715)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41749223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTAACGGCTTKAAGAAGAAATGCCAGAAAGAGGCGGAACAGAACCGA[G/T]AAAAACAGCAGCGGATTGAGACGCTTGAACGATATCTGGCTGACCTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084610 Essential Splice Site 561 746 8 12
ENSDART00000138798 Essential Splice Site 578 763 10 14

The following transcripts of ENSDARG00000060215 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 44460679)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41741187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGAGAAGAAAACACTGCACTGAAAGATGAGCAGCAGCGACTCAAAAAG[G/A]TTCTTAGTCAAACTCATTTTTCTTTATTTACACTAGTAATTTAACAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084610 Nonsense 650 746 11 12
ENSDART00000138798 Nonsense 667 763 13 14

The following transcripts of ENSDARG00000060215 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 44458575)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41739083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGGCGAGGAGCCATCCAGTGGCTGTGGTTTGCTGCCTGCCGGAGCT[C/T]GACTCACCCAGAGGCTGCATGGAGAGATGGCGGCCTGTCTGTGTGACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link