im:7156990

Ensembl ID:
ENSDARG00000060211
ZFIN ID:
ZDB-GENE-060810-68
Human Orthologue:
ANKRD5
Human Description:
ankyrin repeat domain 5 [Source:HGNC Symbol;Acc:15803]
Mouse Orthologue:
Ankrd5
Mouse Description:
ankyrin repeat domain 5 Gene [Source:MGI Symbol;Acc:MGI:2441685]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42881 Nonsense Mutation detected in F1 DNA During 2017
sa32132 Nonsense Available for shipment Available now
sa36348 Essential Splice Site Available for shipment Available now
sa39151 Nonsense Mutation detected in F1 DNA During 2017
sa32131 Nonsense Available for shipment Available now
sa36347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084606 Nonsense 46 663 1 7
Genomic Location (Zv9):
Chromosome 17 (position 12270344)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12252866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGATAGTCTGTACAGGTGTATTCAACCTGATAAACCTGACTGAACCC[A/T]AACATGGACTCGGTGCACTGTATCAGGCAACTGTGGATAAAGATGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084606 Nonsense 207 663 3 7
Genomic Location (Zv9):
Chromosome 17 (position 12269381)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12251903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGCATCTAAAGCTGGTGCATTAAAGCTTGTAAGAGCCATTTCAAAA[A/T]AAGGAGGGAATCCTAACTTAGTTGATGTAGAAGGACGGTGTGCTGCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084606 Essential Splice Site 232 663 3 7
Genomic Location (Zv9):
Chromosome 17 (position 12269302)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12251824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGGACGGTGTGCTGCCCACTTTGCTGCAGAAGGAGGTTTTCTTGAGG[T/G]TATTTAAATGCATTGTTAAGAGCACAAAATGTGGCATTGTTTCACTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084606 Nonsense 275 663 5 7
Genomic Location (Zv9):
Chromosome 17 (position 12265989)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12248511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTACATGAAGTAATATTTTTGATTTTTCTATATCTAAAATAGGATG[T/A]AATCCCAAACTGAGGAATCTGGAAGGTCAACTTCCAAGCCAAGTCGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084606 Nonsense 542 663 5 7
Genomic Location (Zv9):
Chromosome 17 (position 12265190)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12247712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTTCTATAAGACTCCACTTTTGACAGCGTGCAGCTGTGGAAACTAC[C/T]AAGTCGCCGAATTCCTCATTTCACTGGGGTAAGTTTACTAGTTACTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084606 Nonsense 628 663 7 7
Genomic Location (Zv9):
Chromosome 17 (position 12262006)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12244528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATTTTCTTTTTAAGTAAATAGTCAACACAATGTTTGTTTTCCCAGGG[C/T]AAAATTGCTTGGACATTGCTATGATTTATGGCAATGCTAGAATTGTTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link