d2hgdh

Ensembl ID:
ENSDARG00000060210
ZFIN ID:
ZDB-GENE-070112-482
Description:
D-2-hydroxyglutarate dehydrogenase, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:A1L258]
Human Orthologue:
D2HGDH
Human Description:
D-2-hydroxyglutarate dehydrogenase [Source:HGNC Symbol;Acc:28358]
Mouse Orthologues:
AC167963.1, D2hgdh
Mouse Description:
D-2-hydroxyglutarate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2138209]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17480 Essential Splice Site Available for shipment Available now
sa16838 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084597 Essential Splice Site 239 533 5 10
Genomic Location (Zv9):
Chromosome 2 (position 41550957)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 41707361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCTGCGCTAYGGCTCACTTAGAGGGACKGTTCTGGGCCTGGAAGTGG[T/G]GAGCACATTTACATCTASGAGATTCACACRAAAAWTTACTTMAGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084597 Essential Splice Site 296 533 6 10
Genomic Location (Zv9):
Chromosome 2 (position 41553325)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 41704993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATCCTGTGCCCCCGCAAGCCTAAAGCTGTCAATGTAGCCTTTTTAGG[T/G]AAAACACACATCAGAAATAAAGCACAATTCAAACTTGCTAAGATGTTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link