Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
d2hgdh
- Ensembl ID:
- ENSDARG00000060210
- ZFIN ID:
- ZDB-GENE-070112-482
- Description:
- D-2-hydroxyglutarate dehydrogenase, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:A1L258]
- Human Orthologue:
- D2HGDH
- Human Description:
- D-2-hydroxyglutarate dehydrogenase [Source:HGNC Symbol;Acc:28358]
- Mouse Orthologues:
- AC167963.1, D2hgdh
- Mouse Description:
- D-2-hydroxyglutarate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2138209]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa17480 | Essential Splice Site | Available for shipment | Available now |
| sa16838 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17480
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000084597 | Essential Splice Site | 239 | 533 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 2 (position 41550957)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 41707361 GRCz11 2 41556701 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTTCTGCGCTAYGGCTCACTTAGAGGGACKGTTCTGGGCCTGGAAGTGG[T/G]GAGCACATTTACATCTASGAGATTCACACRAAAAWTTACTTMAGTTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16838
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000084597 | Essential Splice Site | 296 | 533 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 2 (position 41553325)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 41704993 GRCz11 2 41554333 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCATCCTGTGCCCCCGCAAGCCTAAAGCTGTCAATGTAGCCTTTTTAGG[T/G]AAAACACACATCAGAAATAAAGCACAATTCAAACTTGCTAAGATGTTAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
