traf7

Ensembl ID:
ENSDARG00000060207
ZFIN ID:
ZDB-GENE-070112-2212
Description:
E3 ubiquitin-protein ligase TRAF7 [Source:RefSeq peptide;Acc:NP_001073654]
Human Orthologue:
TRAF7
Human Description:
TNF receptor-associated factor 7 [Source:HGNC Symbol;Acc:20456]
Mouse Orthologue:
Traf7
Mouse Description:
TNF receptor-associated factor 7 Gene [Source:MGI Symbol;Acc:MGI:3042141]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30605 Essential Splice Site Mutation detected in F1 DNA During 2015
sa14681 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084579 Essential Splice Site 18 639 2 20
ENSDART00000132703 Essential Splice Site 18 639 3 21

The following transcripts of ENSDARG00000060207 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35697175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTGGTTTTGGATCCACGTTTCCAGCAGTCCCACAAGTAGCAAAAGG[T/G]CAGTATTAACTGTTGGACCACATGAATCATATTAGAGCTGTAAAATGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084579 Nonsense 436 639 15 20
ENSDART00000132703 Nonsense 436 639 16 21

The following transcripts of ENSDARG00000060207 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35710869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAGTAACTAATACACNNATNNTCACTTGCTCTTCCTCAGGTTTGGGATATC[C/T]AGACCCTTCAGAAAGTGAACACCATCCGGGCACACGATAACCCTGTGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/scsgiq5q