traf7

Ensembl ID:
ENSDARG00000060207
ZFIN ID:
ZDB-GENE-070112-2212
Description:
E3 ubiquitin-protein ligase TRAF7 [Source:RefSeq peptide;Acc:NP_001073654]
Human Orthologue:
TRAF7
Human Description:
TNF receptor-associated factor 7 [Source:HGNC Symbol;Acc:20456]
Mouse Orthologue:
Traf7
Mouse Description:
TNF receptor-associated factor 7 Gene [Source:MGI Symbol;Acc:MGI:3042141]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14681 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084579 Nonsense 436 639 15 20
ENSDART00000132703 Nonsense 436 639 16 21

The following transcripts of ENSDARG00000060207 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35710869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAGTAACTAATACACNNATNNTCACTTGCTCTTCCTCAGGTTTGGGATATC[C/T]AGACCCTTCAGAAAGTGAACACCATCCGGGCACACGATAACCCTGTGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/scsgiq5q