atp2c1

Ensembl ID:
ENSDARG00000060197
ZFIN ID:
ZDB-GENE-060503-615
Description:
Novel protein similar to vertebrate ATPase, Ca++ transporting, type 2C, member 1 (ATP2C1) [Source:Un
Human Orthologue:
ATP2C1
Human Description:
ATPase, Ca++ transporting, type 2C, member 1 [Source:HGNC Symbol;Acc:13211]
Mouse Orthologue:
Atp2c1
Mouse Description:
ATPase, Ca++-sequestering Gene [Source:MGI Symbol;Acc:MGI:1889008]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12710 Nonsense Available for shipment Available now
sa17127 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084528 Nonsense 201 922 8 27
Genomic Location:
Chromosome 16 (position 44391964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGGCAGTTGACGAGTCCAGTTTGAYAGGTGAAACGACCCCCTGCACC[A/T]AGACCTCTGCCCCTCAACCGGCTGCCACCAATGGCGATATCGCWTCCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084528 Nonsense 516 922 17 27
Genomic Location:
Chromosome 16 (position 44375024)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAGGCGTCACTATGCCTCTRAACAATCAGCAGAGAGACTTCTACCAA[C/T]AGCAGAAGAGCTACATGGGCTCTGGCGGTCTTAGAGGTAAATATTTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sc5fsvyb