si:ch211-214c7.5

Ensembl ID:
ENSDARG00000060187
ZFIN ID:
ZDB-GENE-061207-16
Description:
UPF0575 protein C19orf67 homolog [Source:UniProtKB/Swiss-Prot;Acc:A3KNM4]
Human Orthologue:
C19orf67
Human Description:
chromosome 19 open reading frame 67 [Source:HGNC Symbol;Acc:34354]
Mouse Orthologue:
1700067K01Rik
Mouse Description:
RIKEN cDNA 1700067K01 gene Gene [Source:MGI Symbol;Acc:MGI:1920703]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25648 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101410 Nonsense 216 344 5 7
ENSDART00000133979   None 188 None 4
ENSDART00000141756 Nonsense 149 239 5 7
Genomic Location (Zv9):
Chromosome 1 (position 46218864)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45056376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTTGCCCGACACCGTTTCTTGCCTCATCCCTTACCGGCCTATATAAA[C/T]GAATGCGCTGGAATGTGGAGCGAGAGATTGAGGAAGAAGGAGATGGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link