si:ch211-214c7.6

Ensembl ID:
ENSDARG00000060184
ZFIN ID:
ZDB-GENE-061207-17
Description:
Novel protein similar to H.sapiens PKN1, protein kinase N1 (PKN1) [Source:UniProtKB/TrEMBL;Acc:A2BGV
Human Orthologues:
PKN1, PKN3
Human Descriptions:
protein kinase N1 [Source:HGNC Symbol;Acc:9405]
protein kinase N3 [Source:HGNC Symbol;Acc:17999]
Mouse Orthologues:
Pkn1, Pkn3
Mouse Descriptions:
protein kinase N1 Gene [Source:MGI Symbol;Acc:MGI:108022]
protein kinase N3 Gene [Source:MGI Symbol;Acc:MGI:2388285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25649 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38288 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084512 Essential Splice Site 383 929 7 22
ENSDART00000132555 Essential Splice Site 358 904 6 21
Genomic Location (Zv9):
Chromosome 1 (position 46289257)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45126769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCAGCGTTAGTGGAAAAACACCCCTCAAAACCGACGAACTCTCCTG[T/C]GAGTGTGTGAGGATGTCACGCTTCTAGTGCGTTTTGGCTGTAGTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084512 Splice Site, Nonsense 494 929 11 22
ENSDART00000132555 Splice Site, Nonsense 469 904 10 21
Genomic Location (Zv9):
Chromosome 1 (position 46296501)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45134013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTAACTTTTCTCTTTTGTGTATGTGTTTGTTTGTGATCATACACAGGT[A/T]AAGCATTTTTGCGAGCTCGACAGATGAACGTTGATATTGGCACATTCGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link