si:ch211-65i12.2

Ensembl ID:
ENSDARG00000060175
ZFIN ID:
ZDB-GENE-091118-20
Human Orthologue:
ARHGAP24
Human Description:
Rho GTPase activating protein 24 [Source:HGNC Symbol;Acc:25361]
Mouse Orthologue:
Arhgap24
Mouse Description:
Rho GTPase activating protein 24 Gene [Source:MGI Symbol;Acc:MGI:1922647]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13603 Nonsense Available for shipment Available now
sa17867 Essential Splice Site Available for shipment Available now
sa15362 Nonsense Available for shipment Available now
sa9726 Nonsense Available for shipment Available now
sa23858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084495 Nonsense 106 752 3 9
ENSDART00000137809 Nonsense 17 663 2 8
ENSDART00000140795 Nonsense 17 48 2 4
Genomic Location (Zv9):
Chromosome 21 (position 8528596)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9675563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCCATAGGGGGCGACAGGGAGCGAATGACAWCCAATCATGAGACATA[T/A]CTGCTTATGGCCAGCACACARAATGACATGGAGGATTGGGTGAAGAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084495 Essential Splice Site 203 752 None 9
ENSDART00000137809 Essential Splice Site 114 663 None 8
ENSDART00000140795   None 48 None 4
Genomic Location (Zv9):
Chromosome 21 (position 8547115)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9657044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCTCCAGGACGCTTTCGACTGYGGAGAGWAGCYATCTTTTGACTGG[T/C]ACTTGCTCTTAATGCACTATATTTACAGTGTCTGTTGTGACNTTTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084495 Nonsense 373 752 8 9
ENSDART00000137809 Nonsense 284 663 7 8
ENSDART00000140795   None 48 None 4
ENSDART00000084495 Nonsense 373 752 8 9
ENSDART00000137809 Nonsense 284 663 7 8
ENSDART00000140795   None 48 None 4
Genomic Location (Zv9):
Chromosome 21 (position 8560746)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9643413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAYCAATGGSCAGCTTCAAAACAAAGAGAACAATAACACCACCGGGGCA[C/T]GACAGTGCAYTTGGGATGCCCCCGAATCACCCAACYGYACTCCTCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084495 Nonsense 373 752 8 9
ENSDART00000137809 Nonsense 284 663 7 8
ENSDART00000140795   None 48 None 4
ENSDART00000084495 Nonsense 373 752 8 9
ENSDART00000137809 Nonsense 284 663 7 8
ENSDART00000140795   None 48 None 4
Genomic Location (Zv9):
Chromosome 21 (position 8560746)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9643413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAYCAATGGSCAGCTTCAAAACAAAGAGAACAATAACACCACCGGGGCA[C/T]GACAGTGCAYTTGGGATGCCCCCGAATCACCCAACYGYACTCCTCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084495 Nonsense 631 752 8 9
ENSDART00000137809 Nonsense 542 663 7 8
ENSDART00000140795   None 48 None 4
Genomic Location (Zv9):
Chromosome 21 (position 8561520)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9642639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCAGTAATGGAGGAGGCAGGGGAAGCAGAGGAACCAGCAACAGCAGC[G/T]AGAACAGCGATACGTTTCCTGTCACCAATGGACCGACCAATCACAGCGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link