mns1

Ensembl ID:
ENSDARG00000060169
ZFIN ID:
ZDB-GENE-030521-42
Description:
Meiosis-specific nuclear structural protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PBA8]
Human Orthologue:
MNS1
Human Description:
meiosis-specific nuclear structural 1 [Source:HGNC Symbol;Acc:29636]
Mouse Orthologue:
Mns1
Mouse Description:
meiosis-specific nuclear structural protein 1 Gene [Source:MGI Symbol;Acc:MGI:107933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3644 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084493 Essential Splice Site 450 486 10 10
ENSDART00000127006 Essential Splice Site 467 503 10 10

The following transcripts of ENSDARG00000060169 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 34455084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTWTTRTATTATAATTTATAATATATGTATTTTTTTNATTCTGTA[G/T]GGTATTTTCAAAGAAGAAGATCTGGAGCACTTTGATGAGGATTTTAAAAR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3kulig82