fam160b1

Ensembl ID:
ENSDARG00000060168
ZFIN ID:
ZDB-GENE-070424-63
Description:
hypothetical protein LOC100038786 [Source:RefSeq peptide;Acc:NP_001083035]
Human Orthologue:
FAM160B1
Human Description:
family with sequence similarity 160, member B1 [Source:HGNC Symbol;Acc:29320]
Mouse Orthologue:
Fam160b1
Mouse Description:
family with sequence similarity 160, member B1 Gene [Source:MGI Symbol;Acc:MGI:2147545]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1584 Nonsense Available for shipment Available now
sa28195 Essential Splice Site Mutation detected in F1 DNA During 2015
sa15432 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084474 Nonsense 342 503 8 11
ENSDART00000127930 Nonsense 342 747 8 17
Genomic Location:
Chromosome 13 (position 44252509)
KASP Assay ID:
554-1526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTGCTGCTTTTGCTGGCAAACGTGCACTTATTTCCTTTTTATCGTG[G/A]CTGGACTATTGTGATCAGCTCATCAAAGAGGCTCATAAGGTAAAATCAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa28195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084474 Essential Splice Site 355 503 8 11
ENSDART00000127930 Essential Splice Site 355 747 8 17
Genomic Location:
Chromosome 13 (position 44252468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATCGTGGCTGGACTATTGTGATCAGCTCATCAAAGAGGCTCATAAGG[T/C]AAAATCAATACAAACAAAAAACACAAATTTAACCAAAACAATTATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084474 Nonsense 484 503 11 11
ENSDART00000127930 Nonsense 484 747 11 17
Genomic Location:
Chromosome 13 (position 44249368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCYGGTGCKRCGCTGCTTGGAAGAAAGAAAYTACAGCGAGAACAAA[C/T]AGCAGGAGGAGCGAGAGGAGCGCGAGCACATGGAGAACGGCCAACCGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a6rbd39r