Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam160b1
- Ensembl ID:
- ENSDARG00000060168
- ZFIN ID:
- ZDB-GENE-070424-63
- Description:
- hypothetical protein LOC100038786 [Source:RefSeq peptide;Acc:NP_001083035]
- Human Orthologue:
- FAM160B1
- Human Description:
- family with sequence similarity 160, member B1 [Source:HGNC Symbol;Acc:29320]
- Mouse Orthologue:
- Fam160b1
- Mouse Description:
- family with sequence similarity 160, member B1 Gene [Source:MGI Symbol;Acc:MGI:2147545]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa1584 | Nonsense | Available for shipment | Available now |
| sa28195 | Essential Splice Site | Mutation detected in F1 DNA | During 2017 |
| sa15432 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1584
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000084474 | Nonsense | 342 | 503 | 8 | 11 |
| ENSDART00000127930 | Nonsense | 342 | 747 | 8 | 17 |
- Genomic Location (Zv9):
- Chromosome 13 (position 44252509)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 43489624 - KASP Assay ID:
- 554-1526.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACGCTGCTGCTTTTGCTGGCAAACGTGCACTTATTTCCTTTTTATCGTG[G/A]CTGGACTATTGTGATCAGCTCATCAAAGAGGCTCATAAGGTAAAATCAAT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa28195
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000084474 | Essential Splice Site | 355 | 503 | 8 | 11 |
| ENSDART00000127930 | Essential Splice Site | 355 | 747 | 8 | 17 |
- Genomic Location (Zv9):
- Chromosome 13 (position 44252468)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 43489583 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTATCGTGGCTGGACTATTGTGATCAGCTCATCAAAGAGGCTCATAAGG[T/C]AAAATCAATACAAACAAAAAACACAAATTTAACCAAAACAATTATTTATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15432
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000084474 | Nonsense | 484 | 503 | 11 | 11 |
| ENSDART00000127930 | Nonsense | 484 | 747 | 11 | 17 |
- Genomic Location (Zv9):
- Chromosome 13 (position 44249368)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 43486483 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAACCYGGTGCKRCGCTGCTTGGAAGAAAGAAAYTACAGCGAGAACAAA[C/T]AGCAGGAGGAGCGAGAGGAGCGCGAGCACATGGAGAACGGCCAACCGCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
