fam160b1

Ensembl ID:
ENSDARG00000060168
ZFIN ID:
ZDB-GENE-070424-63
Description:
hypothetical protein LOC100038786 [Source:RefSeq peptide;Acc:NP_001083035]
Human Orthologue:
FAM160B1
Human Description:
family with sequence similarity 160, member B1 [Source:HGNC Symbol;Acc:29320]
Mouse Orthologue:
Fam160b1
Mouse Description:
family with sequence similarity 160, member B1 Gene [Source:MGI Symbol;Acc:MGI:2147545]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1584 Nonsense Available for shipment Available now
sa15432 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084474 Nonsense 342 503 8 11
ENSDART00000127930 Nonsense 342 747 8 17
Genomic Location:
Chromosome 13 (position 44252509)
KASP Assay ID:
554-1526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTGCTGCTTTTGCTGGCAAACGTGCACTTATTTCCTTTTTATCGTG[G/A]CTGGACTATTGTGATCAGCTCATCAAAGAGGCTCATAAGGTAAAATCAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084474 Nonsense 484 503 11 11
ENSDART00000127930 Nonsense 484 747 11 17
Genomic Location:
Chromosome 13 (position 44249368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCYGGTGCKRCGCTGCTTGGAAGAAAGAAAYTACAGCGAGAACAAA[C/T]AGCAGGAGGAGCGAGAGGAGCGCGAGCACATGGAGAACGGCCAACCGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a6rbd39r