fam160b1

Ensembl ID:: ENSDARG00000060168
ZFIN ID:: ZDB-GENE-070424-63
Description:: hypothetical protein LOC100038786 [Source:RefSeq peptide;Acc:NP_001083035]
Human Orthologue:: FAM160B1
Human Description:: family with sequence similarity 160, member B1 [Source:HGNC Symbol;Acc:29320]
Mouse Orthologue:: Fam160b1
Mouse Description:: family with sequence similarity 160, member B1 Gene [Source:MGI Symbol;Acc:MGI:2147545]

Alleles

There are 3 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa1584	Nonsense	Available for shipment	Available now
sa28195	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa15432	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa1584
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000084474	Nonsense	342	503	8	11
ENSDART00000127930	Nonsense	342	747	8	17

Genomic Location:

Chromosome 13 (position 44252509)

KASP Assay ID:

554-1526.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GACGCTGCTGCTTTTGCTGGCAAACGTGCACTTATTTCCTTTTTATCGTG[G/A]CTGGACTATTGTGATCAGCTCATCAAAGAGGCTCATAAGGTAAAATCAAT

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

Mutation Details

Allele Name:: sa28195
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000084474	Essential Splice Site	355	503	8	11
ENSDART00000127930	Essential Splice Site	355	747	8	17

Genomic Location:: Chromosome 13 (position 44252468)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: TTTATCGTGGCTGGACTATTGTGATCAGCTCATCAAAGAGGCTCATAAGG[T/C]AAAATCAATACAAACAAAAAACACAAATTTAACCAAAACAATTATTTATT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa15432
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000084474	Nonsense	484	503	11	11
ENSDART00000127930	Nonsense	484	747	11	17

Genomic Location:: Chromosome 13 (position 44249368)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AAAACCYGGTGCKRCGCTGCTTGGAAGAAAGAAAYTACAGCGAGAACAAA[C/T]AGCAGGAGGAGCGAGAGGAGCGCGAGCACATGGAGAACGGCCAACCGCAT
Associated Phenotype:: Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: