dnah7

Ensembl ID:
ENSDARG00000060165
ZFIN ID:
ZDB-GENE-070912-282
Human Orthologue:
DNAH7
Human Description:
dynein, axonemal, heavy chain 7 [Source:HGNC Symbol;Acc:18661]
Mouse Orthologues:
Dnahc3, Dnahc7a, Dnahc7c
Mouse Descriptions:
dynein, axonemal, heavy chain 3 Gene [Source:MGI Symbol;Acc:MGI:2683040]
dynein, axonemal, heavy chain 7A Gene [Source:MGI Symbol;Acc:MGI:2685838]
dynein, axonemal, heavy chain 7C Gene [Source:MGI Symbol;Acc:MGI:3639762]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34648 Nonsense Mutation detected in F1 DNA During 2017
sa27405 Nonsense Mutation detected in F1 DNA During 2017
sa34647 Nonsense Available for shipment Available now
sa38742 Nonsense Mutation detected in F1 DNA During 2017
sa7185 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2518 Nonsense F2 line generated During 2017
sa41422 Nonsense Mutation detected in F1 DNA During 2017
sa1268 Nonsense Available for shipment Available now
sa34646 Nonsense Mutation detected in F1 DNA During 2017
sa1875 Nonsense Available for shipment Available now
sa21492 Nonsense Available for shipment Available now
sa10194 Nonsense Available for shipment Available now
sa8862 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11115 Nonsense Available for shipment Available now
sa8404 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 135 3984 5 65
ENSDART00000137131 Nonsense 153 4001 5 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26086815)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25242601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTTTCTTTCAGAGGTACTGTTATTACATCCGCAATGGCATCGGCACA[G/T]AAGATGTGGCAGCCATGGAAGATTCCTGGCTTAAGAATGTTCTTGCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 463 3984 12 65
ENSDART00000137131 Nonsense 481 4001 11 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26083650)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25239436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAAGCATGTCCATCTCTATGATAAGTATGCTCCGCTGGTGTCCCAG[C/T]AAGCTGAGGAGGATGTTACTCAGTTTTTGCTGGAGCAGCACTCTTTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 488 3984 12 65
ENSDART00000137131 Nonsense 506 4001 11 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26083573)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25239359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGGAGCAGCACTCTTTCCAGGAGCTGATGATGGAGGTGATCCGCTA[C/A]CAACAACTGGCTGATGAAATCCAATGCAGCACAGTGAAGGTACATGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 762 3984 17 65
ENSDART00000137131 Nonsense 780 4001 16 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26080947)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25236733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTCACAGCCGTCAACCCAGACAAAGTGGAAGTTGATGTGGGAAACTA[C/A]AGCCGTGGCCTATACAAACTGGAGAAAACCTTTCAGGACTTGCCCAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Essential Splice Site 1164 3984 22 65
ENSDART00000137131 Essential Splice Site 1182 4001 21 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26061423)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25217209
KASP Assay ID:
554-5015.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTTACTGGACAAAGGACATTCATGAAGCCATTGCAAAGGGACCAAAG[G/A]TATGTTAAACTGTTGYATGCTTTCCAGAACATCAAGTTCTTATTCTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2518
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 1233 3984 23 65
ENSDART00000137131 Nonsense 1251 4001 22 64
ENSDART00000141957   None 166 None 5
ENSDART00000026924 Nonsense 1233 3984 23 65
ENSDART00000137131 Nonsense 1251 4001 22 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26060548)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25216334
KASP Assay ID:
554-3256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTTGATGATGAGACCAACTTTGAGTGGCTCAGCCAGCTGCGCTACTA[T/A]TGGATTGTAAGCCAGYTTGAKTGTGATTRAAAATGAWATGTGTGTGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 1276 3984 25 65
ENSDART00000137131 Nonsense 1294 4001 24 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26059974)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25215760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGACATTCCTGCAATTTTTGACATGCTTTCTTTTTCAGGACTCTGTTT[G/T]GAGCTTTGCATTTACATCTTGGTGGAGCCCCCGAGGGACCTGCAGGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 1724 3984 33 65
ENSDART00000137131 Nonsense 1742 4001 32 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26040788)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25196574
KASP Assay ID:
554-1183.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTATGATCTACATGGAGCCTCACATGTTGGGATGGCGTCCTGTGATGT[T/A]GTCCTGGCTCAACACCGTGCCRTCCACTTTGAGCTCCATGCACAAAGACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 1788 3984 34 65
ENSDART00000137131 Nonsense 1806 4001 33 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26038231)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25194017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGGTGAAATCTCTGATGAATCTGATGGACTGCATGATGGATGAGTTC[G/T]GAGATGAGAGCCAGATGAAGAGGATGGACCAGAGAGATGTCTGCTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 2267 3984 41 65
ENSDART00000137131 Nonsense 2285 4001 40 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26026968)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25182754
KASP Assay ID:
554-1865.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCCGYCAAGTGGTGGAGACCCATCTTGAAGAGTACAAYAATATCAGC[A/T]AGGCTCCCATGAATCTTGTACTTTTCCGATTTGCCATTGAGCATGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 2490 3984 42 65
ENSDART00000137131 Nonsense 2507 4001 41 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26026163)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25181949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCGTTTCCTGGAAGACGTTGAAATGACAAACACTGCTCGTGAAGGCTG[T/A]ATCAGCATGTGCAAGAGCTTCCACACATCCACCATCGATCTCTCTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 2557 3984 43 65
ENSDART00000137131 Nonsense 2574 4001 42 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26025824)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25181610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATGAAGCTGAAGAGTCGTTATGAGRTTGGTCTTCAGAAGCTGGAAT[C/A]GGCTGCCACACAGGTGTCCACAATGCAGGGGGAGCTGGAGGCTCTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Essential Splice Site 2825 3984 45 65
ENSDART00000137131 Essential Splice Site 2842 4001 44 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26023005)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25178791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGACCCTGGAAACCAACAAGAACAAAAAGGCTGACCTTGAGAATCAGG[T/G]ATGCAGAGGAMAGCAGTCACAAAAGAGTCCACACAAGACTCTGTCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 2859 3984 46 65
ENSDART00000137131 Nonsense 2876 4001 45 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 26020996)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25176782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTAGGAGGAGAGAARTCCCGCTGGAGTGAGACAGCATTTAACTTAGGT[C/T]AACTCTACAACAACCTTACTGGAGACATTCTCATCTCTGCTGCCATAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026924 Nonsense 3854 3984 63 65
ENSDART00000137131 Nonsense 3871 4001 62 64
ENSDART00000141957   None 166 None 5
Genomic Location (Zv9):
Chromosome 9 (position 25990724)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25146510
KASP Assay ID:
2260-1876.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTTTTTCACTCAGGCGTTTCTCACTGGAGGCCAGCAGAATTACGCC[C/T]GAAGATACACCATCCCCATTGACCTGCTCAGCTTCGACTTTGAAGTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link