psmd11a

Ensembl ID:
ENSDARG00000060150
ZFIN ID:
ZDB-GENE-030131-2711
Description:
proteasome 216S subunit, non-ATPase, 11a [Source:RefSeq peptide;Acc:NP_001159710]
Human Orthologue:
PSMD11
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 [Source:HGNC Symbol;Acc:9556]
Mouse Orthologue:
Psmd11
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 Gene [Source:MGI Symbol;Acc:MGI:1916327]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15245 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084448 Nonsense 362 412 11 13
Genomic Location (Zv9):
Chromosome 3 (position 34891124)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34676320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTTCTCAGGGGGAYGTTGAAAGAAAACTYTCACARAWGATTTTAGAC[C/T]AGAAATTCCACGGTATGAACCTTGTCTTTTAGTTAATTAGTGTGCTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link