ablim1a

Ensembl ID:
ENSDARG00000060149
ZFIN ID:
ZDB-GENE-080219-41
Description:
actin-binding LIM protein 1 [Source:RefSeq peptide;Acc:NP_001107788]
Human Orthologue:
ABLIM1
Human Description:
actin binding LIM protein 1 [Source:HGNC Symbol;Acc:78]
Mouse Orthologue:
Ablim1
Mouse Description:
actin-binding LIM protein 1 Gene [Source:MGI Symbol;Acc:MGI:1194500]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa242 Nonsense F2 line generated During 2014
sa10398 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa242
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084416 Nonsense 63 695 2 23
ENSDART00000145705 Nonsense 63 693 2 23
Genomic Location:
Chromosome 13 (position 44196458)
KASP Assay ID:
554-2560.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGATTCGCTGTGCTAAATGTGGAGAGTTGTGCAAAGGAGAGGTGTTA[C/T]GAGTGCAGGCCAAACACTTCCACATCAAGTGCTTCACATGCAAAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084416 Nonsense 680 695 23 23
ENSDART00000145705 Nonsense 678 693 23 23
Genomic Location:
Chromosome 13 (position 44138912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGTGTTCTTCGAAATCTTTGGGATGGAAATTCAGGAATTCAACAGRT[T/A]GCCTCTGTGGAAACGCAATGAACTGAAGAAGAAARCCAAACTCTTCTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/38b89rup