sh3pxd2a

Ensembl ID:
ENSDARG00000060148
ZFIN ID:
ZDB-GENE-060503-271
Description:
SH3 and PX domain-containing protein 2A [Source:UniProtKB/Swiss-Prot;Acc:Q1LYG0]
Human Orthologue:
SH3PXD2A
Human Description:
SH3 and PX domains 2A [Source:HGNC Symbol;Acc:23664]
Mouse Orthologue:
Sh3pxd2a
Mouse Description:
SH3 and PX domains 2A Gene [Source:MGI Symbol;Acc:MGI:1298393]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39678 Nonsense Mutation detected in F1 DNA During 2017
sa32757 Nonsense Mutation detected in F1 DNA During 2017
sa19571 Nonsense Available for shipment Available now
sa19572 Nonsense Available for shipment Available now
sa19573 Nonsense Available for shipment Available now
sa31233 Nonsense Available for shipment Available now
sa19574 Nonsense Available for shipment Available now
sa10307 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 197 1068 7 12
ENSDART00000109244 Nonsense 264 1140 10 16
Genomic Location (Zv9):
Chromosome 1 (position 48164667)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46976328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAGGCTCGACCGGAGATGGACACTAGGGGGAATAGTCAACCGCCAA[C/T]AGAGCCGAGGTGAAACATACATACAGTCACGCCTGCATAGACTGATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 431 1068 12 12
ENSDART00000109244 Nonsense 503 1140 16 16
Genomic Location (Zv9):
Chromosome 1 (position 48178449)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46990110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTATGTAATATGTGGTCTTCAGGTCATAGAAAAGAACTCTGGAGGAT[G/A]GTGGTATGTCCAGATTGGGGATACGGAGGGCTGGGCACCCAGCTCATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 762 1068 12 12
ENSDART00000109244 Nonsense 834 1140 16 16
Genomic Location (Zv9):
Chromosome 1 (position 48179441)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46991102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCTCCAGTGTTTATTCAAAGGGTAGCCGAGGTGGAGAATCCGACCAC[G/T]AAAGTGTGCTCTTTAGGACCACAGATGCCTATGAACGAGCCCAGGAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 799 1068 12 12
ENSDART00000109244 Nonsense 871 1140 16 16
Genomic Location (Zv9):
Chromosome 1 (position 48179553)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46991214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGCTGGTGTGGAGGTTGAGGTACTGGAGAAGCAGGAAAGTGGATGGT[G/A]GTTTGTTCGTTGGGGCAGTGATGAGGGTTGGGTACCTACTTTTTACTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 814 1068 12 12
ENSDART00000109244 Nonsense 886 1140 16 16
Genomic Location (Zv9):
Chromosome 1 (position 48179599)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46991260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGTTTGTTCGTTGGGGCAGTGATGAGGGTTGGGTACCTACTTTTTA[C/A]TTGGAGCCGATTAAACATACCCACAACGTCGGTATTCAAGAATCCCGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 815 1068 12 12
ENSDART00000109244 Nonsense 887 1140 16 16
Genomic Location (Zv9):
Chromosome 1 (position 48179601)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46991262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTTGTTCGTTGGGGCAGTGATGAGGGTTGGGTACCTACTTTTTACT[T/A]GGAGCCGATTAAACATACCCACAACGTCGGTATTCAAGAATCCCGTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 1018 1068 12 12
ENSDART00000109244 Nonsense 1090 1140 16 16
Genomic Location (Zv9):
Chromosome 1 (position 48180211)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46991872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTCATTCACAACAACCTTCGAGAGGTTTACGTATCCATCGCAGATTA[T/A]CGCGGAGATGAAGAGACCATGGGTTTTTCAGAGGGCACTTCTCTTGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084457 Nonsense 1034 1068 12 12
ENSDART00000109244 Nonsense 1106 1140 16 16
Genomic Location (Zv9):
Chromosome 1 (position 48180257)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46991918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCGCGGAGATGAAGAGAYCATGGGTTTTTCAGAGGGCACTTCTCTT[G/T]AAGTTTTGGRGAAGAATCCAAATGGATGGTGGTACTGCCAGGTTCTCGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link