LOC568788

Ensembl ID:
ENSDARG00000060127
Human Orthologue:
ADAMTS3
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 3 [Source:HGNC Symbol;Acc:219]
Mouse Orthologue:
Adamts3
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3 Gene [

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33692 Nonsense Mutation detected in F1 DNA During 2016
sa9777 Essential Splice Site Available for shipment Available now
sa33693 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Nonsense 32 1071 3 23
Genomic Location:
Chromosome 5 (position 46944202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAACACGACAAGAATTTTAATATAATCAGTGTTTGTCTTGTGTTATCT[T/A]AGATTTGTTGAAGAACCGTCTGAAAGAGTATGGCCTCATTACTCCCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Essential Splice Site 582 1071 13 23
Genomic Location:
Chromosome 5 (position 47073491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTGGGATGGGTGTKCGCTTCAGAMCCCGCCAGTGCAACAACCCTGTG[T/C]AGGTTATACACTGATTTCACAGTCAGGATTGCTAKRAACACTTACTAAKA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Nonsense 914 1071 21 23
Genomic Location:
Chromosome 5 (position 47151955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTCTTTTTGTCTCATGTCAGGTGGATCACCGAAGAGTGGGAACATTG[T/A]ACTAAAACATGTGGAAGCTTGGGATATCAAATCCGTACTGTGCGCTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link