timm17b

Ensembl ID:
ENSDARG00000060124
ZFIN ID:
ZDB-GENE-081104-144
Description:
mitochondrial import inner membrane translocase subunit Tim17-B [Source:RefSeq peptide;Acc:NP_00110
Human Orthologue:
TIMM17B
Human Description:
translocase of inner mitochondrial membrane 17 homolog B (yeast) [Source:HGNC Symbol;Acc:17310]
Mouse Orthologue:
Timm17b
Mouse Description:
translocase of inner mitochondrial membrane 17b Gene [Source:MGI Symbol;Acc:MGI:1343176]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5505 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084417 Essential Splice Site 107 167 5 6
Genomic Location:
Chromosome 8 (position 46617894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGTTTGCAAGATGGAAAATATTTGCATTACTTGCATGTTTGTATTTC[A/C]GGTGGTCCCCTCGCTATGGTGGGCTCTGCAATGATGGGTGGAATTCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5nuocr90