ca16b

Ensembl ID:
ENSDARG00000060123
ZFIN ID:
ZDB-GENE-080818-1
Description:
Protein turosine phosphatase gamma B [Source:UniProtKB/TrEMBL;Acc:D2U7Y3]
Human Orthologue:
PTPRG
Human Description:
protein tyrosine phosphatase, receptor type, G [Source:HGNC Symbol;Acc:9671]
Mouse Orthologue:
Ptprg
Mouse Description:
protein tyrosine phosphatase, receptor type, G Gene [Source:MGI Symbol;Acc:MGI:97814]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12018 Nonsense Available for shipment Available now
sa7588 Missense Mutation detected in F1 DNA During 2014
sa9647 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017309 Nonsense 584 1382 12 29
ENSDART00000122241 None None 217 None 7
ENSDART00000126246 None None 253 None 9
Genomic Location:
Chromosome 6 (position 45944685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAAAAGAGGACGATGAAGAGGAGGANNNNNNAGAGGAAGAAGAARAA[C/T]AGAGAGATGAGGAGAAGAAGAAGAAGGGGAAAGATGTGACRGTCAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017309 Missense 671 1382 12 29
ENSDART00000122241 None None 217 None 7
ENSDART00000126246 None None 253 None 9
Genomic Location:
Chromosome 6 (position 45944424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACATGGCAGGAYGATAATGATATGCAGATTCCCTCCAGCTYTACAGAA[A/T]GCAGCAAACTGAGTGACGAGGAGAAAGCAAACTGGCCATACTACATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017309 Nonsense 935 1382 19 29
ENSDART00000122241 None None 217 None 7
ENSDART00000126246 None None 253 None 9
Genomic Location:
Chromosome 6 (position 45909571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATAATGGTGACTCTGAAGARCACTAAAGTTTATGCTTACTATACACTM[C/T]GACATTTCATCRTACGCAACAGCAAACTGAAAAAGGTGCGTTAAAGCATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kyw07jym