lrrn1

Ensembl ID:
ENSDARG00000060115
ZFIN ID:
ZDB-GENE-071126-1
Description:
leucine rich repeat neuronal 1 [Source:RefSeq peptide;Acc:NP_001124166]
Human Orthologue:
LRRN1
Human Description:
leucine rich repeat neuronal 1 [Source:HGNC Symbol;Acc:20980]
Mouse Orthologue:
Lrrn1
Mouse Description:
leucine rich repeat protein 1, neuronal Gene [Source:MGI Symbol;Acc:MGI:106038]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18488 Nonsense Available for shipment Available now
hu3284 Missense Confirmed mutation in F2 line Unknown
hu3586 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084389 Nonsense 134 717 2 2
Genomic Location:
Chromosome 6 (position 43010376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACATGTCACAACTCACGACTCTTCACCTGGAGGAGAACCAAATAGTT[G/T]AGATGCCTGACTTCAGTTTGCAGGAWCTYACCAATCTWCAGGAGCTGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3284
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084389 Missense 290 717 2 2
Genomic Location:
Chromosome 6 (position 43009907)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCCAATACATAAAATTCAAGAGGGGGACTTTAAGAACATGCTCAGGC[T/G]GAAAGAACTTGGCATTAACAACATGGGAGAACTTGTGTCCATTGATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084389 Nonsense 407 717 2 2
Genomic Location:
Chromosome 6 (position 43009557)
KASP Assay ID:
554-0130.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGATTCATGGAGCCTCTTTCTATGTTCTGCACCATGCCGATTGAAGTT[A/T]GAGGTCAGCGCGTGAGAGATGTGTTTTCTCGTGAACCTTCAGGCCAGTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n70c0k8b