aggf1

Ensembl ID:
ENSDARG00000060109
ZFIN ID:
ZDB-GENE-060929-836
Description:
angiogenic factor with G patch and FHA domains 1 [Source:RefSeq peptide;Acc:NP_001073451]
Human Orthologue:
AGGF1
Human Description:
angiogenic factor with G patch and FHA domains 1 [Source:HGNC Symbol;Acc:24684]
Mouse Orthologue:
Aggf1
Mouse Description:
angiogenic factor with G patch and FHA domains 1 Gene [Source:MGI Symbol;Acc:MGI:1913799]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23854 Nonsense Mutation detected in F1 DNA During 2016
sa3148 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43584 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084380 Nonsense 55 763 1 14
Genomic Location:
Chromosome 21 (position 7708805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCGCTGCGAGAGGAGCTGAAGACCTGTAAAGATGAGCTCCAGAAGT[T/A]ACAGAAACAGCTCAGCCAAAGCGAACGGCTCCAGAAGACCACAGAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084380 Essential Splice Site 592 763 10 14
Genomic Location:
Chromosome 21 (position 7690592)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAGATCATAGCACACTTGAGCCGCCATAAGAAAGACGAAAGCTCTGG[T/C]ATGCACAACATGACTGCATTAACTTAACCTGATTATGCTTAATAAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084380 Nonsense 726 763 14 14
Genomic Location:
Chromosome 21 (position 7682143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATCCGCCATGTCTGTTGAGGATGCTTCGCTCACCAAATCCAAAACA[C/T]AGAGAAACTGGGAGCGCGCAAGAGAACGGTTCTCTGAAGCCTGCCACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link