aggf1

Ensembl ID:
ENSDARG00000060109
ZFIN ID:
ZDB-GENE-060929-836
Description:
angiogenic factor with G patch and FHA domains 1 [Source:RefSeq peptide;Acc:NP_001073451]
Human Orthologue:
AGGF1
Human Description:
angiogenic factor with G patch and FHA domains 1 [Source:HGNC Symbol;Acc:24684]
Mouse Orthologue:
Aggf1
Mouse Description:
angiogenic factor with G patch and FHA domains 1 Gene [Source:MGI Symbol;Acc:MGI:1913799]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23854 Nonsense Mutation detected in F1 DNA During 2016
sa43584 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084380 Nonsense 55 763 1 14
Genomic Location (Zv9):
Chromosome 21 (position 7708805)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8031067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCGCTGCGAGAGGAGCTGAAGACCTGTAAAGATGAGCTCCAGAAGT[T/A]ACAGAAACAGCTCAGCCAAAGCGAACGGCTCCAGAAGACCACAGAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084380 Nonsense 726 763 14 14
Genomic Location (Zv9):
Chromosome 21 (position 7682143)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8004405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATCCGCCATGTCTGTTGAGGATGCTTCGCTCACCAAATCCAAAACA[C/T]AGAGAAACTGGGAGCGCGCAAGAGAACGGTTCTCTGAAGCCTGCCACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link