crb2

Ensembl ID:
ENSDARG00000060106
ZFIN ID:
ZDB-GENE-060612-1
Description:
crumbs homolog 2 [Source:RefSeq peptide;Acc:NP_001038764]
Human Orthologue:
CRB2
Human Description:
crumbs homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:18688]
Mouse Orthologue:
Crb2
Mouse Description:
crumbs homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679260]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12901 Nonsense Available for shipment Available now
sa18328 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084378 Nonsense 403 1466 5 13
Genomic Location:
Chromosome 21 (position 7984580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACACTGGGAAACAGACTGGGAGTTCACTTATGCCACAGCTGTGGGCTA[T/A]GTATGTCAGTGCCAACCAGGATWCACAGGTACTGGYAACGTCACTACACR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084378 Nonsense 1108 1466 10 13
Genomic Location:
Chromosome 21 (position 7981785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAGTGAAGTTCTCTGGACAGAGACKCATAGCAGATGGAAACTGGCAT[C/T]GACTGCTGTTTGCGATGGCCCACCCAGAGCAKGATGCRTCACAGTGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3wyjtvgp