crb2

Ensembl ID:
ENSDARG00000060106
ZFIN ID:
ZDB-GENE-060612-1
Description:
crumbs homolog 2 [Source:RefSeq peptide;Acc:NP_001038764]
Human Orthologue:
CRB2
Human Description:
crumbs homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:18688]
Mouse Orthologue:
Crb2
Mouse Description:
crumbs homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679260]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12901 Nonsense Available for shipment Available now
sa32334 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18328 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084378 Nonsense 403 1466 5 13
Genomic Location (Zv9):
Chromosome 21 (position 7984580)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8392131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACACTGGGAAACAGACTGGGAGTTCACTTATGCCACAGCTGTGGGCTA[T/A]GTATGTCAGTGCCAACCAGGATWCACAGGTACTGGYAACGTCACTACACR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084378 Essential Splice Site 1021 1466 9 13
Genomic Location (Zv9):
Chromosome 21 (position 7982155)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8389706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATGCATAAATGGTGGACACTGCGTAGATCTGTTGGATGGTTTTGAAT[G/A]TACGAAGCAGATTTTTGACAATTTCTTGATTGCTTGCTAAAGACTAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084378 Nonsense 1108 1466 10 13
Genomic Location (Zv9):
Chromosome 21 (position 7981785)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8389336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAGTGAAGTTCTCTGGACAGAGACKCATAGCAGATGGAAACTGGCAT[C/T]GACTGCTGTTTGCGATGGCCCACCCAGAGCAKGATGCRTCACAGTGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link