cpeb3

Ensembl ID:
ENSDARG00000060103
ZFIN ID:
ZDB-GENE-090312-68
Description:
cytoplasmic polyadenylation element-binding protein 3 [Source:RefSeq peptide;Acc:NP_001161134]
Human Orthologue:
CPEB3
Human Description:
cytoplasmic polyadenylation element binding protein 3 [Source:HGNC Symbol;Acc:21746]
Mouse Orthologue:
Cpeb3
Mouse Description:
cytoplasmic polyadenylation element binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:2443075]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17508 Essential Splice Site Available for shipment Available now
sa42284 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12175 Nonsense Available for shipment Available now
sa6328 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Essential Splice Site 231 586 1 10
Genomic Location (Zv9):
Chromosome 13 (position 43060679)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42281638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGAGCCCTTCAGAACTGACAACAGCAACAACATGCTGCCATTTCAGG[T/A]GAGATTCTTCACTTCATCAATAGASGTAAWGCNNATAGGGCTGAGGTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Essential Splice Site 232 586 2 10
Genomic Location (Zv9):
Chromosome 13 (position 43067434)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42288393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACACATCTTTCACCTGTGACCTTTAACACCTTTCCTTTTGTCTTTCA[G/A]GATCGAAATCGACCCTTCGACCCCTTCAACTTGCAGACTTTGGAAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Nonsense 275 586 3 10
Genomic Location (Zv9):
Chromosome 13 (position 43083981)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42304940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGRTCGCATGGGTCTCAACTTTCACCATCCAGTAGCTGAACATATAT[T/G]ACCACTRAACAGTGAGTATCTCTCTTTAACTGTGATATTAATGCTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Nonsense 517 586 10 10
Genomic Location (Zv9):
Chromosome 13 (position 43124831)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42345790
KASP Assay ID:
554-4694.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCWTAAACCAGTGAATTTYTGTGTGTGCACAGGTGGAGGTGAAGCCGTA[T/A]GTTCTGGATGATCAGATGTGTGATGAATGTCAGGGMTCTCGTTGYGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link