cpeb3

Ensembl ID:
ENSDARG00000060103
ZFIN ID:
ZDB-GENE-090312-68
Description:
cytoplasmic polyadenylation element-binding protein 3 [Source:RefSeq peptide;Acc:NP_001161134]
Human Orthologue:
CPEB3
Human Description:
cytoplasmic polyadenylation element binding protein 3 [Source:HGNC Symbol;Acc:21746]
Mouse Orthologue:
Cpeb3
Mouse Description:
cytoplasmic polyadenylation element binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:2443075]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17508 Essential Splice Site Available for shipment Available now
sa12175 Nonsense Available for shipment Available now
sa4528 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6328 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Essential Splice Site 231 586 1 10
Genomic Location:
Chromosome 13 (position 43060679)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGAGCCCTTCAGAACTGACAACAGCAACAACATGCTGCCATTTCAGG[T/A]GAGATTCTTCACTTCATCAATAGASGTAAWGCNNATAGGGCTGAGGTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Nonsense 275 586 3 10
Genomic Location:
Chromosome 13 (position 43083981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGRTCGCATGGGTCTCAACTTTCACCATCCAGTAGCTGAACATATAT[T/G]ACCACTRAACAGTGAGTATCTCTCTTTAACTGTGATATTAATGCTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Essential Splice Site 413 586 8 10
Genomic Location:
Chromosome 13 (position 43120347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTATTAAAYAYGCATGGAATTGGCTTGAYATTCCAACACTCCTCCTC[A/T]GGTTCAGATTCGCCCGTGGAACCTCAGTGACAGTGATTTTGTRATGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084354 Nonsense 517 586 10 10
Genomic Location:
Chromosome 13 (position 43124831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCWTAAACCAGTGAATTTYTGTGTGTGCACAGGTGGAGGTGAAGCCGTA[T/A]GTTCTGGATGATCAGATGTGTGATGAATGTCAGGGMTCTCGTTGYGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w60h1371