si:dkey-146l2.1

Ensembl ID:
ENSDARG00000060102
ZFIN ID:
ZDB-GENE-060526-215
Description:
Novel protein similar to vertebrate ankyrin repeat domain 15 (ANKRD15) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
KANK1
Human Description:
KN motif and ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:19309]
Mouse Orthologue:
Kank1
Mouse Description:
KN motif and ankyrin repeat domains 1 Gene [Source:MGI Symbol;Acc:MGI:2147707]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26558 Nonsense Mutation detected in F1 DNA During 2017
sa2231 Nonsense F2 line generated During 2017
sa2225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084370 Nonsense 471 1335 3 12
ENSDART00000136521 Nonsense 471 1335 4 13
ENSDART00000145299   None 187 None 3

The following transcripts of ENSDARG00000060102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46538130)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44319395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACCAGACCATCGAAGCCCTCAAAGAGAAGATTTACAGATTGGAGGTT[C/T]AACTTAAGGAGACGACCCACCAAATGGAAATGGGAAAGCTAAAGCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2231
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084370 Nonsense 609 1335 3 12
ENSDART00000136521 Nonsense 609 1335 4 13
ENSDART00000145299   None 187 None 3

The following transcripts of ENSDARG00000060102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46538545)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44319810
KASP Assay ID:
554-2916.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAAGYGTATGTGAAATGGGAATCAACACGGAGTTAACAGCTGAAGGTT[T/A]AGGACTTTGCAAAAGAGAGGCTGAACAAGCCAAGGAGTTCAGGTCTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084370 Nonsense 696 1335 3 12
ENSDART00000136521 Nonsense 696 1335 4 13
ENSDART00000145299   None 187 None 3

The following transcripts of ENSDARG00000060102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46538805)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44320070
KASP Assay ID:
554-2873.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTAACCAATACAGACAAGTTAGTTCTTACTGATACCTCCACCAATACA[C/T]AATCATGCTCAAAAGACAAACAAGTCGGCACCGAACCGTTAGAGACACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link