ttc15

Ensembl ID:
ENSDARG00000060101
ZFIN ID:
ZDB-GENE-070112-1282
Description:
tetratricopeptide repeat protein 15 [Source:RefSeq peptide;Acc:NP_001074113]
Human Orthologue:
TTC15
Human Description:
tetratricopeptide repeat domain 15 [Source:HGNC Symbol;Acc:24284]
Mouse Orthologue:
Ttc15
Mouse Description:
tetratricopeptide repeat domain 15 Gene [Source:MGI Symbol;Acc:MGI:2445089]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8941 Nonsense Mutation detected in F1 DNA During 2017
sa44879 Nonsense Mutation detected in F1 DNA During 2017
sa2901 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa8941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084348 Nonsense 30 760 1 13
Genomic Location (Zv9):
Chromosome 17 (position 51785594)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51171340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGGATATAGATGCAGGCATTGAGASCCCCGAGACCTCTGTCCCACCC[C/T]AGAAYGACCTAASAGAAGCTTCATTTCGAGAGGAGAGCATCGATYTGRAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084348 Nonsense 227 760 2 13
Genomic Location (Zv9):
Chromosome 17 (position 51782368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACCACGGGCAGCACAGAAACCCCCAACAAACTCATCCCGCAGGTGTG[C/A]CAGCCGAGTCCCAGCCTCAGTAAGTTCTTCACGGATAACGGCGCGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2901
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084348 Nonsense 487 760 5 13
Genomic Location (Zv9):
Chromosome 17 (position 51770541)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51156287
KASP Assay ID:
554-2617.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTGGAGCCGTTCGGGGATCTGGATCATCCAAACCTTTACTATGAGTA[T/G]TACCCCGCCRTTTACCCGGGAAGACGAGGTAAATGCATGTAAACCGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link