ttc15

Ensembl ID:
ENSDARG00000060101
ZFIN ID:
ZDB-GENE-070112-1282
Description:
tetratricopeptide repeat protein 15 [Source:RefSeq peptide;Acc:NP_001074113]
Human Orthologue:
TTC15
Human Description:
tetratricopeptide repeat domain 15 [Source:HGNC Symbol;Acc:24284]
Mouse Orthologue:
Ttc15
Mouse Description:
tetratricopeptide repeat domain 15 Gene [Source:MGI Symbol;Acc:MGI:2445089]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8941 Nonsense Mutation detected in F1 DNA During 2014
sa2901 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa8941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084348 Nonsense 30 760 1 13
Genomic Location:
Chromosome 17 (position 51785594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGGATATAGATGCAGGCATTGAGASCCCCGAGACCTCTGTCCCACCC[C/T]AGAAYGACCTAASAGAAGCTTCATTTCGAGAGGAGAGCATCGATYTGRAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2901
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084348 Nonsense 487 760 5 13
Genomic Location:
Chromosome 17 (position 51770541)
KASP Assay ID:
554-2617.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTGGAGCCGTTCGGGGATCTGGATCATCCAAACCTTTACTATGAGTA[T/G]TACCCCGCCRTTTACCCGGGAAGACGAGGTAAATGCATGTAAACCGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jgqh2n4u