kcnb1

Ensembl ID:
ENSDARG00000060095
Human Orthologue:
KCNB1
Human Description:
potassium voltage-gated channel, Shab-related subfamily, member 1 [Source:HGNC Symbol;Acc:6231]
Mouse Orthologue:
Kcnb1
Mouse Description:
potassium voltage gated channel, Shab-related subfamily, member 1 Gene [Source:MGI Symbol;Acc:MGI:96

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40781 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084361 Nonsense 133 831 1 2
Genomic Location (Zv9):
Chromosome 6 (position 46496984)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46557918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCTGGACTACTGGGGAGTGGATGAGATCTACTTGGAGTCGTGCTG[C/A]CAGGCCAGATACCATCAAAAGAAGGAGCAGATGAACGAGGAGCTCAAGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link