ptgisl

Ensembl ID:
ENSDARG00000060094
ZFIN ID:
ZDB-GENE-070116-1
Description:
prostacyclin synthase [Source:RefSeq peptide;Acc:NP_001104630]
Human Orthologue:
PTGIS
Human Description:
prostaglandin I2 (prostacyclin) synthase [Source:HGNC Symbol;Acc:9603]
Mouse Orthologue:
Ptgis
Mouse Description:
prostaglandin I2 (prostacyclin) synthase Gene [Source:MGI Symbol;Acc:MGI:1097156]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38576 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084334 Nonsense 168 480 4 10
ENSDART00000084343 Nonsense 175 404 4 9

The following transcripts of ENSDARG00000060094 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 46522284)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46583218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTCAAAACATCTGAGTGGAAAAAAGATGGACTGTTCAATCTTTGCTA[C/A]AGCTTGCTCTTCAAGTAAGCCAACCTCTAAAATCAACATACCAGTAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link